Incidental Mutation 'R5043:Ifi206'
ID393282
Institutional Source Beutler Lab
Gene Symbol Ifi206
Ensembl Gene ENSMUSG00000037849
Gene Nameinterferon activated gene 206
SynonymsGm4955, Pyblhin-C
MMRRC Submission 042633-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R5043 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173468485-173491041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 173486718 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 52 (M52K)
Ref Sequence ENSEMBL: ENSMUSP00000134646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160565]
Predicted Effect probably damaging
Transcript: ENSMUST00000160565
AA Change: M52K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134646
Gene: ENSMUSG00000037849
AA Change: M52K

DomainStartEndE-ValueType
PYRIN 6 84 5.7e-21 SMART
low complexity region 97 108 N/A INTRINSIC
internal_repeat_1 154 349 6.25e-15 PROSPERO
internal_repeat_1 342 575 6.25e-15 PROSPERO
Meta Mutation Damage Score 0.7094 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,044,100 Y106* probably null Het
1700061G19Rik A G 17: 56,885,198 Y587C probably damaging Het
Akap12 G C 10: 4,355,047 G619A probably damaging Het
Arhgap29 A G 3: 121,974,004 K32E probably benign Het
Capg T A 6: 72,558,254 Y253* probably null Het
Cntnap3 A T 13: 64,794,348 F189L probably damaging Het
Cp T C 3: 19,973,917 S496P probably benign Het
Cxcl11 T C 5: 92,363,152 probably null Het
Dennd3 T C 15: 73,527,936 L217P probably benign Het
Dip2c G T 13: 9,551,827 R274L possibly damaging Het
Dnah12 C T 14: 26,884,190 S3776L probably damaging Het
Emcn A G 3: 137,391,601 T94A possibly damaging Het
Fnip2 A T 3: 79,492,867 Y397* probably null Het
Gabrp T C 11: 33,568,072 N79D probably benign Het
Glmp T G 3: 88,326,676 probably benign Het
Gm12794 T C 4: 101,940,524 F40L possibly damaging Het
Gm5921 C T 9: 115,438,019 noncoding transcript Het
Gm6483 A G 8: 19,693,670 T104A probably benign Het
Iqcc T C 4: 129,618,277 probably benign Het
Klra2 T A 6: 131,220,172 H288L probably benign Het
Myo5b T C 18: 74,638,153 probably null Het
Nisch A G 14: 31,176,465 probably benign Het
Nlrp4c A G 7: 6,066,825 N575S probably benign Het
Olfr354 A C 2: 36,906,965 R6S probably benign Het
Olfr913 A G 9: 38,594,841 I207V probably damaging Het
Phlda1 T A 10: 111,507,291 L296Q unknown Het
Rab36 G A 10: 75,051,005 E182K probably benign Het
Rasa3 G A 8: 13,570,368 T767M possibly damaging Het
Serpinb11 G A 1: 107,369,465 V24M probably damaging Het
Slc7a14 T G 3: 31,237,466 N221T probably damaging Het
Smg6 T C 11: 74,929,895 S331P possibly damaging Het
Snx1 C T 9: 66,097,436 A183T probably benign Het
Srpk2 T C 5: 23,524,517 T375A probably benign Het
Tecpr1 T C 5: 144,197,854 probably null Het
Topaz1 A T 9: 122,748,404 E126D probably benign Het
Ugt2b1 C G 5: 86,917,644 C512S possibly damaging Het
Ugt2b37 C T 5: 87,251,860 W263* probably null Het
Utp20 A T 10: 88,798,746 M750K possibly damaging Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp609 T C 9: 65,700,827 Y1257C probably damaging Het
Other mutations in Ifi206
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01509:Ifi206 APN 1 173485576 missense probably benign 0.00
IGL02044:Ifi206 APN 1 173480991 missense probably benign 0.41
IGL02118:Ifi206 APN 1 173481768 missense probably benign 0.05
IGL02476:Ifi206 APN 1 173481566 missense probably benign 0.02
IGL02824:Ifi206 APN 1 173481872 missense possibly damaging 0.95
IGL03375:Ifi206 APN 1 173480778 missense probably benign 0.06
PIT4142001:Ifi206 UTSW 1 173481164 missense probably benign 0.02
R0069:Ifi206 UTSW 1 173486847 missense probably damaging 1.00
R0741:Ifi206 UTSW 1 173473749 missense probably benign 0.41
R1572:Ifi206 UTSW 1 173486853 missense probably benign 0.10
R1742:Ifi206 UTSW 1 173481971 missense probably benign 0.06
R4109:Ifi206 UTSW 1 173480988 missense probably benign 0.00
R4707:Ifi206 UTSW 1 173480866 missense probably benign 0.00
R4783:Ifi206 UTSW 1 173480866 missense probably benign 0.00
R4785:Ifi206 UTSW 1 173480866 missense probably benign 0.00
R4805:Ifi206 UTSW 1 173481386 missense possibly damaging 0.55
R4918:Ifi206 UTSW 1 173482044 missense possibly damaging 0.73
R5080:Ifi206 UTSW 1 173473848 missense possibly damaging 0.61
R5419:Ifi206 UTSW 1 173481231 missense probably benign 0.05
R5420:Ifi206 UTSW 1 173481033 missense possibly damaging 0.84
R5777:Ifi206 UTSW 1 173481362 missense possibly damaging 0.55
R5988:Ifi206 UTSW 1 173481340 missense possibly damaging 0.90
R6772:Ifi206 UTSW 1 173481207 missense unknown
R6782:Ifi206 UTSW 1 173481357 missense unknown
R6806:Ifi206 UTSW 1 173481571 missense probably benign 0.06
R7042:Ifi206 UTSW 1 173481242 missense
R7091:Ifi206 UTSW 1 173473875 missense unknown
R7292:Ifi206 UTSW 1 173473862 missense unknown
R7429:Ifi206 UTSW 1 173480591 missense
R7499:Ifi206 UTSW 1 173482041 missense
R7772:Ifi206 UTSW 1 173481074 missense
R7853:Ifi206 UTSW 1 173471534 nonsense probably null
R7971:Ifi206 UTSW 1 173471410 missense unknown
R8079:Ifi206 UTSW 1 173481158 missense
R8390:Ifi206 UTSW 1 173480945 missense
R8500:Ifi206 UTSW 1 173486745 missense
R8712:Ifi206 UTSW 1 173480508 missense
R8753:Ifi206 UTSW 1 173473657 missense unknown
R8875:Ifi206 UTSW 1 173473787 missense unknown
X0052:Ifi206 UTSW 1 173481969 missense possibly damaging 0.89
Z1088:Ifi206 UTSW 1 173474011 missense probably damaging 1.00
Z1176:Ifi206 UTSW 1 173482048 missense
Predicted Primers PCR Primer
(F):5'- AGCTGGCAAGTTTAGGGATG -3'
(R):5'- GCTGTTTGCTACCTAGATATGCTC -3'

Sequencing Primer
(F):5'- CTGGCAAGTTTAGGGATGGTAGAG -3'
(R):5'- AATGGTCTCTTATGTGTGTAATTCAG -3'
Posted On2016-06-15