Incidental Mutation 'R5043:Cp'
ID 393284
Institutional Source Beutler Lab
Gene Symbol Cp
Ensembl Gene ENSMUSG00000003617
Gene Name ceruloplasmin
Synonyms D3Ertd555e
MMRRC Submission 042633-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5043 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 20011218-20063309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20028081 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 496 (S496P)
Ref Sequence ENSEMBL: ENSMUSP00000103965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003714] [ENSMUST00000091309] [ENSMUST00000108325] [ENSMUST00000108328] [ENSMUST00000108329]
AlphaFold Q61147
Predicted Effect probably benign
Transcript: ENSMUST00000003714
AA Change: S496P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003714
Gene: ENSMUSG00000003617
AA Change: S496P

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091309
AA Change: S496P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088857
Gene: ENSMUSG00000003617
AA Change: S496P

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 7.7e-8 PFAM
Pfam:Cu-oxidase 220 357 1.1e-11 PFAM
Pfam:Cu-oxidase_2 280 357 2e-7 PFAM
Pfam:Cu-oxidase_3 444 557 4.6e-7 PFAM
Blast:FA58C 599 674 2e-6 BLAST
Pfam:Cu-oxidase_3 790 898 3.4e-9 PFAM
Pfam:Cu-oxidase_2 928 1055 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108325
AA Change: S496P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103961
Gene: ENSMUSG00000003617
AA Change: S496P

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 4.9e-8 PFAM
Pfam:Cu-oxidase 220 357 9.3e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 2e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.2e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108328
AA Change: S496P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103964
Gene: ENSMUSG00000003617
AA Change: S496P

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108329
AA Change: S496P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103965
Gene: ENSMUSG00000003617
AA Change: S496P

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 89 203 8.7e-8 PFAM
Pfam:Cu-oxidase 220 357 7.8e-12 PFAM
Pfam:Cu-oxidase_2 242 356 2.1e-7 PFAM
Pfam:Cu-oxidase_3 445 555 4.4e-7 PFAM
Blast:FA58C 599 674 3e-6 BLAST
Pfam:Cu-oxidase_3 793 898 6.1e-9 PFAM
Pfam:Cu-oxidase_2 931 1055 5.2e-18 PFAM
low complexity region 1068 1079 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128615
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: The protein encoded by this gene is a copper-containing glycoprotein found soluble in the serum and GPI-anchored in other tissues. It oxidizes Fe(II) to Fe(III) and is proposed to play an important role in iron homeostasis. In humans mutations of this gene cause aceruloplasminemia, which is characterized by retinal degeneration, diabetes, anemia and neurological symptoms. In mouse deficiency of this gene in combination with a deficiency of its homolog hephaestin causes retinal degeneration and serves as a pathophysiological model for aceruloplasminemia and age-related macular degeneration. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit progressive accumulation of stored iron in the liver, spleen, cerebellum, and brainstem, mild iron deficiency anemia, and impaired motor coordination associated with loss of brainstem dopaminergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 144,980,910 (GRCm39) Y106* probably null Het
Acsbg3 A G 17: 57,192,198 (GRCm39) Y587C probably damaging Het
Akap12 G C 10: 4,305,047 (GRCm39) G619A probably damaging Het
Arhgap29 A G 3: 121,767,653 (GRCm39) K32E probably benign Het
Capg T A 6: 72,535,237 (GRCm39) Y253* probably null Het
Cntnap3 A T 13: 64,942,162 (GRCm39) F189L probably damaging Het
Cxcl11 T C 5: 92,511,011 (GRCm39) probably null Het
Dennd3 T C 15: 73,399,785 (GRCm39) L217P probably benign Het
Dip2c G T 13: 9,601,863 (GRCm39) R274L possibly damaging Het
Dnah12 C T 14: 26,606,147 (GRCm39) S3776L probably damaging Het
Emcn A G 3: 137,097,362 (GRCm39) T94A possibly damaging Het
Fnip2 A T 3: 79,400,174 (GRCm39) Y397* probably null Het
Gabrp T C 11: 33,518,072 (GRCm39) N79D probably benign Het
Glmp T G 3: 88,233,983 (GRCm39) probably benign Het
Gm5921 C T 9: 115,267,087 (GRCm39) noncoding transcript Het
Gm6483 A G 8: 19,743,686 (GRCm39) T104A probably benign Het
Ifi206 A T 1: 173,314,284 (GRCm39) M52K probably damaging Het
Iqcc T C 4: 129,512,070 (GRCm39) probably benign Het
Klra2 T A 6: 131,197,135 (GRCm39) H288L probably benign Het
Myo5b T C 18: 74,771,224 (GRCm39) probably null Het
Nisch A G 14: 30,898,422 (GRCm39) probably benign Het
Nlrp4c A G 7: 6,069,824 (GRCm39) N575S probably benign Het
Or1n2 A C 2: 36,796,977 (GRCm39) R6S probably benign Het
Or8b49 A G 9: 38,506,137 (GRCm39) I207V probably damaging Het
Phlda1 T A 10: 111,343,152 (GRCm39) L296Q unknown Het
Pramel19 T C 4: 101,797,721 (GRCm39) F40L possibly damaging Het
Rab36 G A 10: 74,886,837 (GRCm39) E182K probably benign Het
Rasa3 G A 8: 13,620,368 (GRCm39) T767M possibly damaging Het
Serpinb11 G A 1: 107,297,195 (GRCm39) V24M probably damaging Het
Slc7a14 T G 3: 31,291,615 (GRCm39) N221T probably damaging Het
Smg6 T C 11: 74,820,721 (GRCm39) S331P possibly damaging Het
Snx1 C T 9: 66,004,718 (GRCm39) A183T probably benign Het
Srpk2 T C 5: 23,729,515 (GRCm39) T375A probably benign Het
Tecpr1 T C 5: 144,134,672 (GRCm39) probably null Het
Topaz1 A T 9: 122,577,469 (GRCm39) E126D probably benign Het
Ugt2b1 C G 5: 87,065,503 (GRCm39) C512S possibly damaging Het
Ugt2b37 C T 5: 87,399,719 (GRCm39) W263* probably null Het
Utp20 A T 10: 88,634,608 (GRCm39) M750K possibly damaging Het
Yeats2 A T 16: 20,027,215 (GRCm39) Q822L probably damaging Het
Zfp609 T C 9: 65,608,109 (GRCm39) Y1257C probably damaging Het
Other mutations in Cp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Cp APN 3 20,039,826 (GRCm39) missense possibly damaging 0.95
IGL00923:Cp APN 3 20,024,165 (GRCm39) missense probably damaging 1.00
IGL01302:Cp APN 3 20,020,531 (GRCm39) missense probably damaging 0.99
IGL01407:Cp APN 3 20,031,369 (GRCm39) missense possibly damaging 0.79
IGL01505:Cp APN 3 20,031,356 (GRCm39) missense possibly damaging 0.83
IGL01677:Cp APN 3 20,020,598 (GRCm39) missense probably damaging 1.00
IGL02013:Cp APN 3 20,042,213 (GRCm39) missense probably damaging 1.00
IGL02114:Cp APN 3 20,020,511 (GRCm39) missense probably benign 0.16
IGL02950:Cp APN 3 20,042,165 (GRCm39) missense probably damaging 0.99
IGL03330:Cp APN 3 20,020,599 (GRCm39) missense probably damaging 1.00
iron10 UTSW 3 20,043,311 (GRCm39) unclassified probably benign
R0008:Cp UTSW 3 20,022,287 (GRCm39) missense probably damaging 1.00
R0008:Cp UTSW 3 20,022,287 (GRCm39) missense probably damaging 1.00
R0320:Cp UTSW 3 20,029,012 (GRCm39) splice site probably benign
R0632:Cp UTSW 3 20,025,246 (GRCm39) missense probably null 0.98
R1103:Cp UTSW 3 20,036,149 (GRCm39) missense possibly damaging 0.82
R1137:Cp UTSW 3 20,033,116 (GRCm39) missense probably benign 0.04
R1199:Cp UTSW 3 20,031,316 (GRCm39) missense probably damaging 1.00
R1523:Cp UTSW 3 20,043,229 (GRCm39) missense probably benign 0.00
R1629:Cp UTSW 3 20,020,614 (GRCm39) critical splice donor site probably null
R1678:Cp UTSW 3 20,026,881 (GRCm39) missense probably damaging 0.99
R1733:Cp UTSW 3 20,022,383 (GRCm39) splice site probably benign
R1779:Cp UTSW 3 20,011,549 (GRCm39) missense possibly damaging 0.91
R1816:Cp UTSW 3 20,022,384 (GRCm39) splice site probably benign
R1990:Cp UTSW 3 20,033,177 (GRCm39) missense probably damaging 1.00
R2014:Cp UTSW 3 20,041,598 (GRCm39) missense probably benign 0.00
R2179:Cp UTSW 3 20,042,151 (GRCm39) missense probably damaging 1.00
R2249:Cp UTSW 3 20,041,734 (GRCm39) missense probably damaging 1.00
R3440:Cp UTSW 3 20,029,121 (GRCm39) missense probably benign 0.02
R3441:Cp UTSW 3 20,029,121 (GRCm39) missense probably benign 0.02
R3886:Cp UTSW 3 20,043,275 (GRCm39) missense probably damaging 1.00
R3937:Cp UTSW 3 20,025,198 (GRCm39) missense probably damaging 1.00
R4387:Cp UTSW 3 20,031,366 (GRCm39) missense probably damaging 1.00
R4412:Cp UTSW 3 20,020,517 (GRCm39) missense probably damaging 1.00
R4413:Cp UTSW 3 20,020,517 (GRCm39) missense probably damaging 1.00
R4514:Cp UTSW 3 20,042,177 (GRCm39) missense probably damaging 0.99
R4578:Cp UTSW 3 20,028,052 (GRCm39) missense probably damaging 1.00
R4579:Cp UTSW 3 20,011,599 (GRCm39) splice site probably null
R4694:Cp UTSW 3 20,029,049 (GRCm39) missense probably benign 0.07
R4724:Cp UTSW 3 20,026,811 (GRCm39) missense probably benign 0.02
R4910:Cp UTSW 3 20,043,388 (GRCm39) unclassified probably benign
R4960:Cp UTSW 3 20,027,961 (GRCm39) missense probably damaging 0.96
R5063:Cp UTSW 3 20,043,379 (GRCm39) missense probably benign 0.27
R5294:Cp UTSW 3 20,020,480 (GRCm39) missense probably benign 0.00
R5382:Cp UTSW 3 20,033,089 (GRCm39) missense probably damaging 1.00
R5404:Cp UTSW 3 20,043,292 (GRCm39) missense possibly damaging 0.92
R5569:Cp UTSW 3 20,033,041 (GRCm39) missense probably damaging 1.00
R5789:Cp UTSW 3 20,011,454 (GRCm39) missense probably benign
R5943:Cp UTSW 3 20,018,470 (GRCm39) missense probably benign 0.11
R6492:Cp UTSW 3 20,036,186 (GRCm39) missense probably benign 0.20
R6540:Cp UTSW 3 20,018,693 (GRCm39) critical splice donor site probably null
R7007:Cp UTSW 3 20,024,137 (GRCm39) missense probably damaging 0.97
R7126:Cp UTSW 3 20,034,788 (GRCm39) missense probably damaging 1.00
R7136:Cp UTSW 3 20,039,822 (GRCm39) nonsense probably null
R7212:Cp UTSW 3 20,029,130 (GRCm39) missense probably damaging 1.00
R7269:Cp UTSW 3 20,037,641 (GRCm39) missense probably damaging 1.00
R7316:Cp UTSW 3 20,026,916 (GRCm39) missense probably damaging 1.00
R7336:Cp UTSW 3 20,018,696 (GRCm39) splice site probably null
R7361:Cp UTSW 3 20,018,470 (GRCm39) missense probably benign 0.11
R7578:Cp UTSW 3 20,043,262 (GRCm39) missense possibly damaging 0.65
R7593:Cp UTSW 3 20,020,494 (GRCm39) missense probably benign 0.00
R7782:Cp UTSW 3 20,029,223 (GRCm39) critical splice donor site probably null
R7858:Cp UTSW 3 20,025,219 (GRCm39) missense probably benign 0.05
R8246:Cp UTSW 3 20,029,186 (GRCm39) missense probably damaging 1.00
R8247:Cp UTSW 3 20,020,570 (GRCm39) missense possibly damaging 0.84
R8300:Cp UTSW 3 20,011,385 (GRCm39) start gained probably benign
R8507:Cp UTSW 3 20,025,193 (GRCm39) missense probably damaging 1.00
R8756:Cp UTSW 3 20,059,736 (GRCm39) critical splice donor site probably null
R8826:Cp UTSW 3 20,039,739 (GRCm39) missense probably damaging 1.00
R8875:Cp UTSW 3 20,027,994 (GRCm39) missense possibly damaging 0.94
R9018:Cp UTSW 3 20,043,316 (GRCm39) missense probably damaging 1.00
R9072:Cp UTSW 3 20,033,158 (GRCm39) missense possibly damaging 0.91
R9111:Cp UTSW 3 20,027,949 (GRCm39) missense probably damaging 1.00
R9439:Cp UTSW 3 20,046,671 (GRCm39) critical splice acceptor site probably null
R9443:Cp UTSW 3 20,033,083 (GRCm39) missense possibly damaging 0.84
R9460:Cp UTSW 3 20,018,566 (GRCm39) missense
R9733:Cp UTSW 3 20,033,126 (GRCm39) missense probably damaging 1.00
R9748:Cp UTSW 3 20,043,335 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TGAAGACAACTAATGCTCGCTTTG -3'
(R):5'- CTCTAATCTTAACATTGCAGGACC -3'

Sequencing Primer
(F):5'- AACTAATGCTCGCTTTGTCCCTAGG -3'
(R):5'- TTGCAGGACCTTAAAAACATTCAC -3'
Posted On 2016-06-15