Incidental Mutation 'R5043:Fnip2'
ID393287
Institutional Source Beutler Lab
Gene Symbol Fnip2
Ensembl Gene ENSMUSG00000061175
Gene Namefolliculin interacting protein 2
SynonymsD630023B12Rik
MMRRC Submission 042633-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5043 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location79455974-79567796 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 79492867 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 397 (Y397*)
Ref Sequence ENSEMBL: ENSMUSP00000115275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076136] [ENSMUST00000133154]
Predicted Effect probably null
Transcript: ENSMUST00000076136
AA Change: Y367*
SMART Domains Protein: ENSMUSP00000075497
Gene: ENSMUSG00000061175
AA Change: Y367*

DomainStartEndE-ValueType
Pfam:FNIP_N 42 168 4.3e-39 PFAM
low complexity region 240 261 N/A INTRINSIC
Pfam:FNIP_M 289 528 5.9e-92 PFAM
low complexity region 557 571 N/A INTRINSIC
low complexity region 748 755 N/A INTRINSIC
Pfam:FNIP_C 920 1104 4.1e-73 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000133154
AA Change: Y397*
SMART Domains Protein: ENSMUSP00000115275
Gene: ENSMUSG00000061175
AA Change: Y397*

DomainStartEndE-ValueType
Pfam:FNIP_N 42 164 5.2e-34 PFAM
low complexity region 270 291 N/A INTRINSIC
Pfam:FNIP_M 323 557 3.9e-93 PFAM
low complexity region 587 601 N/A INTRINSIC
low complexity region 778 785 N/A INTRINSIC
Pfam:FNIP_C 951 1134 2.3e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154645
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in regulating the O6-methylguanine-induced apoptosis signaling pathway. This protein may also play a role cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 1, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele have normal lifespans. Mice with combined loss of this gene and a single null allele of Fnip1 develop kidney cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,044,100 Y106* probably null Het
1700061G19Rik A G 17: 56,885,198 Y587C probably damaging Het
Akap12 G C 10: 4,355,047 G619A probably damaging Het
Arhgap29 A G 3: 121,974,004 K32E probably benign Het
Capg T A 6: 72,558,254 Y253* probably null Het
Cntnap3 A T 13: 64,794,348 F189L probably damaging Het
Cp T C 3: 19,973,917 S496P probably benign Het
Cxcl11 T C 5: 92,363,152 probably null Het
Dennd3 T C 15: 73,527,936 L217P probably benign Het
Dip2c G T 13: 9,551,827 R274L possibly damaging Het
Dnah12 C T 14: 26,884,190 S3776L probably damaging Het
Emcn A G 3: 137,391,601 T94A possibly damaging Het
Gabrp T C 11: 33,568,072 N79D probably benign Het
Glmp T G 3: 88,326,676 probably benign Het
Gm12794 T C 4: 101,940,524 F40L possibly damaging Het
Gm5921 C T 9: 115,438,019 noncoding transcript Het
Gm6483 A G 8: 19,693,670 T104A probably benign Het
Ifi206 A T 1: 173,486,718 M52K probably damaging Het
Iqcc T C 4: 129,618,277 probably benign Het
Klra2 T A 6: 131,220,172 H288L probably benign Het
Myo5b T C 18: 74,638,153 probably null Het
Nisch A G 14: 31,176,465 probably benign Het
Nlrp4c A G 7: 6,066,825 N575S probably benign Het
Olfr354 A C 2: 36,906,965 R6S probably benign Het
Olfr913 A G 9: 38,594,841 I207V probably damaging Het
Phlda1 T A 10: 111,507,291 L296Q unknown Het
Rab36 G A 10: 75,051,005 E182K probably benign Het
Rasa3 G A 8: 13,570,368 T767M possibly damaging Het
Serpinb11 G A 1: 107,369,465 V24M probably damaging Het
Slc7a14 T G 3: 31,237,466 N221T probably damaging Het
Smg6 T C 11: 74,929,895 S331P possibly damaging Het
Snx1 C T 9: 66,097,436 A183T probably benign Het
Srpk2 T C 5: 23,524,517 T375A probably benign Het
Tecpr1 T C 5: 144,197,854 probably null Het
Topaz1 A T 9: 122,748,404 E126D probably benign Het
Ugt2b1 C G 5: 86,917,644 C512S possibly damaging Het
Ugt2b37 C T 5: 87,251,860 W263* probably null Het
Utp20 A T 10: 88,798,746 M750K possibly damaging Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp609 T C 9: 65,700,827 Y1257C probably damaging Het
Other mutations in Fnip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Fnip2 APN 3 79481521 missense probably benign
IGL00339:Fnip2 APN 3 79515155 missense probably benign 0.12
IGL00340:Fnip2 APN 3 79518061 splice site probably benign
IGL00434:Fnip2 APN 3 79512489 splice site probably benign
IGL01134:Fnip2 APN 3 79512503 nonsense probably null
IGL02732:Fnip2 APN 3 79465697 missense probably damaging 1.00
IGL03327:Fnip2 APN 3 79518081 missense probably damaging 0.98
IGL03402:Fnip2 APN 3 79481276 missense possibly damaging 0.92
R0314:Fnip2 UTSW 3 79481189 missense probably damaging 1.00
R0318:Fnip2 UTSW 3 79512378 missense probably damaging 1.00
R0699:Fnip2 UTSW 3 79481139 missense probably benign 0.00
R1188:Fnip2 UTSW 3 79462162 missense probably damaging 1.00
R1290:Fnip2 UTSW 3 79465693 missense probably damaging 1.00
R1406:Fnip2 UTSW 3 79508091 missense possibly damaging 0.85
R1406:Fnip2 UTSW 3 79508091 missense possibly damaging 0.85
R1535:Fnip2 UTSW 3 79481765 missense probably damaging 1.00
R1618:Fnip2 UTSW 3 79508168 missense possibly damaging 0.70
R1661:Fnip2 UTSW 3 79515149 missense probably benign
R1665:Fnip2 UTSW 3 79515149 missense probably benign
R1965:Fnip2 UTSW 3 79493472 missense probably benign 0.31
R1966:Fnip2 UTSW 3 79493472 missense probably benign 0.31
R1976:Fnip2 UTSW 3 79480931 missense probably benign 0.02
R2004:Fnip2 UTSW 3 79512325 splice site probably benign
R2054:Fnip2 UTSW 3 79572465 unclassified probably benign
R2145:Fnip2 UTSW 3 79500432 missense probably damaging 0.99
R2400:Fnip2 UTSW 3 79479634 missense probably benign 0.03
R2679:Fnip2 UTSW 3 79480926 missense probably benign 0.13
R3157:Fnip2 UTSW 3 79567594 missense probably damaging 1.00
R3851:Fnip2 UTSW 3 79462157 missense probably damaging 1.00
R3910:Fnip2 UTSW 3 79479505 missense possibly damaging 0.83
R3911:Fnip2 UTSW 3 79479505 missense possibly damaging 0.83
R3912:Fnip2 UTSW 3 79479505 missense possibly damaging 0.83
R4035:Fnip2 UTSW 3 79479501 missense probably benign 0.00
R4166:Fnip2 UTSW 3 79462135 missense probably damaging 1.00
R4537:Fnip2 UTSW 3 79465714 missense probably damaging 0.98
R4732:Fnip2 UTSW 3 79481652 missense probably damaging 1.00
R4733:Fnip2 UTSW 3 79481652 missense probably damaging 1.00
R4774:Fnip2 UTSW 3 79465721 nonsense probably null
R4923:Fnip2 UTSW 3 79489394 critical splice acceptor site probably null
R5160:Fnip2 UTSW 3 79488991 missense probably damaging 1.00
R5162:Fnip2 UTSW 3 79481777 missense probably damaging 1.00
R5196:Fnip2 UTSW 3 79572538 unclassified probably benign
R5283:Fnip2 UTSW 3 79465708 missense probably damaging 1.00
R5364:Fnip2 UTSW 3 79481168 missense probably benign 0.00
R5402:Fnip2 UTSW 3 79480943 missense possibly damaging 0.89
R6340:Fnip2 UTSW 3 79507845 missense probably damaging 1.00
R6459:Fnip2 UTSW 3 79481634 missense possibly damaging 0.93
R6592:Fnip2 UTSW 3 79481708 missense probably benign 0.26
R6616:Fnip2 UTSW 3 79480882 missense probably benign 0.00
R6933:Fnip2 UTSW 3 79518111 missense probably benign 0.28
R6962:Fnip2 UTSW 3 79489303 missense probably damaging 1.00
R6971:Fnip2 UTSW 3 79481121 nonsense probably null
R7050:Fnip2 UTSW 3 79506270 missense probably damaging 0.99
R7097:Fnip2 UTSW 3 79481006 missense probably benign
R7315:Fnip2 UTSW 3 79506205 critical splice donor site probably null
R7714:Fnip2 UTSW 3 79518114 missense probably damaging 1.00
R7782:Fnip2 UTSW 3 79508123 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACCCTGCTCTCATGGGTAG -3'
(R):5'- TTTTAAGGCTAGAGACCAGGGTG -3'

Sequencing Primer
(F):5'- CTCTCATGGGTAGCGACACTAAG -3'
(R):5'- GATGAGGAAGAATGTCATTACCATC -3'
Posted On2016-06-15