Mutagenetix > Incidental Mutations

Incidental Mutation 'R5043:Fnip2'

393287

Institutional Source

Beutler Lab

Gene Symbol

Fnip2

Ensembl Gene

ENSMUSG00000061175

Gene Name

folliculin interacting protein 2

Synonyms

D630023B12Rik

MMRRC Submission

042633-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5043 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79455974-79567796 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 79492867 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 397 (Y397*)

Ref Sequence

ENSEMBL: ENSMUSP00000115275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076136] [ENSMUST00000133154]

AlphaFold

Q80TD3

Predicted Effect

probably null
Transcript: ENSMUST00000076136
AA Change: Y367*

SMART Domains

Protein: ENSMUSP00000075497
Gene: ENSMUSG00000061175
AA Change: Y367*

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	42	168	4.3e-39	PFAM
low complexity region	240	261	N/A	INTRINSIC
Pfam:FNIP_M	289	528	5.9e-92	PFAM
low complexity region	557	571	N/A	INTRINSIC
low complexity region	748	755	N/A	INTRINSIC
Pfam:FNIP_C	920	1104	4.1e-73	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000133154
AA Change: Y397*

SMART Domains

Protein: ENSMUSP00000115275
Gene: ENSMUSG00000061175
AA Change: Y397*

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	42	164	5.2e-34	PFAM
low complexity region	270	291	N/A	INTRINSIC
Pfam:FNIP_M	323	557	3.9e-93	PFAM
low complexity region	587	601	N/A	INTRINSIC
low complexity region	778	785	N/A	INTRINSIC
Pfam:FNIP_C	951	1134	2.3e-74	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154645

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.4%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in regulating the O6-methylguanine-induced apoptosis signaling pathway. This protein may also play a role cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 1, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele have normal lifespans. Mice with combined loss of this gene and a single null allele of Fnip1 develop kidney cancer. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018F24Rik	T	A	5: 145,044,100	Y106*	probably null	Het
1700061G19Rik	A	G	17: 56,885,198	Y587C	probably damaging	Het
Akap12	G	C	10: 4,355,047	G619A	probably damaging	Het
Arhgap29	A	G	3: 121,974,004	K32E	probably benign	Het
Capg	T	A	6: 72,558,254	Y253*	probably null	Het
Cntnap3	A	T	13: 64,794,348	F189L	probably damaging	Het
Cp	T	C	3: 19,973,917	S496P	probably benign	Het
Cxcl11	T	C	5: 92,363,152		probably null	Het
Dennd3	T	C	15: 73,527,936	L217P	probably benign	Het
Dip2c	G	T	13: 9,551,827	R274L	possibly damaging	Het
Dnah12	C	T	14: 26,884,190	S3776L	probably damaging	Het
Emcn	A	G	3: 137,391,601	T94A	possibly damaging	Het
Gabrp	T	C	11: 33,568,072	N79D	probably benign	Het
Glmp	T	G	3: 88,326,676		probably benign	Het
Gm12794	T	C	4: 101,940,524	F40L	possibly damaging	Het
Gm5921	C	T	9: 115,438,019		noncoding transcript	Het
Gm6483	A	G	8: 19,693,670	T104A	probably benign	Het
Ifi206	A	T	1: 173,486,718	M52K	probably damaging	Het
Iqcc	T	C	4: 129,618,277		probably benign	Het
Klra2	T	A	6: 131,220,172	H288L	probably benign	Het
Myo5b	T	C	18: 74,638,153		probably null	Het
Nisch	A	G	14: 31,176,465		probably benign	Het
Nlrp4c	A	G	7: 6,066,825	N575S	probably benign	Het
Olfr354	A	C	2: 36,906,965	R6S	probably benign	Het
Olfr913	A	G	9: 38,594,841	I207V	probably damaging	Het
Phlda1	T	A	10: 111,507,291	L296Q	unknown	Het
Rab36	G	A	10: 75,051,005	E182K	probably benign	Het
Rasa3	G	A	8: 13,570,368	T767M	possibly damaging	Het
Serpinb11	G	A	1: 107,369,465	V24M	probably damaging	Het
Slc7a14	T	G	3: 31,237,466	N221T	probably damaging	Het
Smg6	T	C	11: 74,929,895	S331P	possibly damaging	Het
Snx1	C	T	9: 66,097,436	A183T	probably benign	Het
Srpk2	T	C	5: 23,524,517	T375A	probably benign	Het
Tecpr1	T	C	5: 144,197,854		probably null	Het
Topaz1	A	T	9: 122,748,404	E126D	probably benign	Het
Ugt2b1	C	G	5: 86,917,644	C512S	possibly damaging	Het
Ugt2b37	C	T	5: 87,251,860	W263*	probably null	Het
Utp20	A	T	10: 88,798,746	M750K	possibly damaging	Het
Yeats2	A	T	16: 20,208,465	Q822L	probably damaging	Het
Zfp609	T	C	9: 65,700,827	Y1257C	probably damaging	Het

Other mutations in Fnip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Fnip2	APN	3	79481521	missense	probably benign
IGL00339:Fnip2	APN	3	79515155	missense	probably benign	0.12
IGL00340:Fnip2	APN	3	79518061	splice site	probably benign
IGL00434:Fnip2	APN	3	79512489	splice site	probably benign
IGL01134:Fnip2	APN	3	79512503	nonsense	probably null
IGL02732:Fnip2	APN	3	79465697	missense	probably damaging	1.00
IGL03327:Fnip2	APN	3	79518081	missense	probably damaging	0.98
IGL03402:Fnip2	APN	3	79481276	missense	possibly damaging	0.92
R0314:Fnip2	UTSW	3	79481189	missense	probably damaging	1.00
R0318:Fnip2	UTSW	3	79512378	missense	probably damaging	1.00
R0699:Fnip2	UTSW	3	79481139	missense	probably benign	0.00
R1188:Fnip2	UTSW	3	79462162	missense	probably damaging	1.00
R1290:Fnip2	UTSW	3	79465693	missense	probably damaging	1.00
R1406:Fnip2	UTSW	3	79508091	missense	possibly damaging	0.85
R1406:Fnip2	UTSW	3	79508091	missense	possibly damaging	0.85
R1535:Fnip2	UTSW	3	79481765	missense	probably damaging	1.00
R1618:Fnip2	UTSW	3	79508168	missense	possibly damaging	0.70
R1661:Fnip2	UTSW	3	79515149	missense	probably benign
R1665:Fnip2	UTSW	3	79515149	missense	probably benign
R1965:Fnip2	UTSW	3	79493472	missense	probably benign	0.31
R1966:Fnip2	UTSW	3	79493472	missense	probably benign	0.31
R1976:Fnip2	UTSW	3	79480931	missense	probably benign	0.02
R2004:Fnip2	UTSW	3	79512325	splice site	probably benign
R2054:Fnip2	UTSW	3	79572465	unclassified	probably benign
R2145:Fnip2	UTSW	3	79500432	missense	probably damaging	0.99
R2400:Fnip2	UTSW	3	79479634	missense	probably benign	0.03
R2679:Fnip2	UTSW	3	79480926	missense	probably benign	0.13
R3157:Fnip2	UTSW	3	79567594	missense	probably damaging	1.00
R3851:Fnip2	UTSW	3	79462157	missense	probably damaging	1.00
R3910:Fnip2	UTSW	3	79479505	missense	possibly damaging	0.83
R3911:Fnip2	UTSW	3	79479505	missense	possibly damaging	0.83
R3912:Fnip2	UTSW	3	79479505	missense	possibly damaging	0.83
R4035:Fnip2	UTSW	3	79479501	missense	probably benign	0.00
R4166:Fnip2	UTSW	3	79462135	missense	probably damaging	1.00
R4537:Fnip2	UTSW	3	79465714	missense	probably damaging	0.98
R4732:Fnip2	UTSW	3	79481652	missense	probably damaging	1.00
R4733:Fnip2	UTSW	3	79481652	missense	probably damaging	1.00
R4774:Fnip2	UTSW	3	79465721	nonsense	probably null
R4923:Fnip2	UTSW	3	79489394	critical splice acceptor site	probably null
R5160:Fnip2	UTSW	3	79488991	missense	probably damaging	1.00
R5162:Fnip2	UTSW	3	79481777	missense	probably damaging	1.00
R5196:Fnip2	UTSW	3	79572538	unclassified	probably benign
R5283:Fnip2	UTSW	3	79465708	missense	probably damaging	1.00
R5364:Fnip2	UTSW	3	79481168	missense	probably benign	0.00
R5402:Fnip2	UTSW	3	79480943	missense	possibly damaging	0.89
R6340:Fnip2	UTSW	3	79507845	missense	probably damaging	1.00
R6459:Fnip2	UTSW	3	79481634	missense	possibly damaging	0.93
R6592:Fnip2	UTSW	3	79481708	missense	probably benign	0.26
R6616:Fnip2	UTSW	3	79480882	missense	probably benign	0.00
R6933:Fnip2	UTSW	3	79518111	missense	probably benign	0.28
R6962:Fnip2	UTSW	3	79489303	missense	probably damaging	1.00
R6971:Fnip2	UTSW	3	79481121	nonsense	probably null
R7050:Fnip2	UTSW	3	79506270	missense	probably damaging	0.99
R7097:Fnip2	UTSW	3	79481006	missense	probably benign
R7315:Fnip2	UTSW	3	79506205	critical splice donor site	probably null
R7714:Fnip2	UTSW	3	79518114	missense	probably damaging	1.00
R7782:Fnip2	UTSW	3	79508123	missense	probably benign	0.00
R8381:Fnip2	UTSW	3	79465693	missense	probably damaging	1.00
R8479:Fnip2	UTSW	3	79512555	missense	probably damaging	1.00
R8485:Fnip2	UTSW	3	79481537	missense	probably benign	0.35
R9344:Fnip2	UTSW	3	79500410	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TACCCTGCTCTCATGGGTAG -3'
(R):5'- TTTTAAGGCTAGAGACCAGGGTG -3'

Sequencing Primer
(F):5'- CTCTCATGGGTAGCGACACTAAG -3'
(R):5'- GATGAGGAAGAATGTCATTACCATC -3'

Posted On

2016-06-15