Incidental Mutation 'R5043:Glmp'
ID393288
Institutional Source Beutler Lab
Gene Symbol Glmp
Ensembl Gene ENSMUSG00000001418
Gene Nameglycosylated lysosomal membrane protein
SynonymsNCU-G1, 0610031J06Rik
MMRRC Submission 042633-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R5043 (G1)
Quality Score83
Status Validated
Chromosome3
Chromosomal Location88325023-88331313 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 88326676 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001452] [ENSMUST00000001454] [ENSMUST00000001456] [ENSMUST00000107552] [ENSMUST00000107553] [ENSMUST00000131666] [ENSMUST00000154381] [ENSMUST00000164166] [ENSMUST00000176425] [ENSMUST00000176519] [ENSMUST00000177005]
Predicted Effect probably benign
Transcript: ENSMUST00000001452
SMART Domains Protein: ENSMUSP00000001452
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 33 527 3.2e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000001454
SMART Domains Protein: ENSMUSP00000001454
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 53 130 2.7e-26 PFAM
Pfam:NCU-G1 124 333 4.8e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000001456
SMART Domains Protein: ENSMUSP00000001456
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107552
SMART Domains Protein: ENSMUSP00000103176
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107553
SMART Domains Protein: ENSMUSP00000103177
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131666
SMART Domains Protein: ENSMUSP00000120235
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153716
Predicted Effect probably benign
Transcript: ENSMUST00000154381
SMART Domains Protein: ENSMUSP00000134809
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
Pfam:NCU-G1 2 72 5.4e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164122
Predicted Effect probably benign
Transcript: ENSMUST00000164166
SMART Domains Protein: ENSMUSP00000126109
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 15 489 1.7e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168971
SMART Domains Protein: ENSMUSP00000131250
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 38 5.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176425
SMART Domains Protein: ENSMUSP00000135575
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 37 314 3.3e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176519
SMART Domains Protein: ENSMUSP00000135263
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 53 125 4.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177005
SMART Domains Protein: ENSMUSP00000135398
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 54 397 1.1e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193646
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Homozygous mutants for this allele displayed spontaneous development of liver fibrosis at 6 months and various hepatic cell phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,044,100 Y106* probably null Het
1700061G19Rik A G 17: 56,885,198 Y587C probably damaging Het
Akap12 G C 10: 4,355,047 G619A probably damaging Het
Arhgap29 A G 3: 121,974,004 K32E probably benign Het
Capg T A 6: 72,558,254 Y253* probably null Het
Cntnap3 A T 13: 64,794,348 F189L probably damaging Het
Cp T C 3: 19,973,917 S496P probably benign Het
Cxcl11 T C 5: 92,363,152 probably null Het
Dennd3 T C 15: 73,527,936 L217P probably benign Het
Dip2c G T 13: 9,551,827 R274L possibly damaging Het
Dnah12 C T 14: 26,884,190 S3776L probably damaging Het
Emcn A G 3: 137,391,601 T94A possibly damaging Het
Fnip2 A T 3: 79,492,867 Y397* probably null Het
Gabrp T C 11: 33,568,072 N79D probably benign Het
Gm12794 T C 4: 101,940,524 F40L possibly damaging Het
Gm5921 C T 9: 115,438,019 noncoding transcript Het
Gm6483 A G 8: 19,693,670 T104A probably benign Het
Ifi206 A T 1: 173,486,718 M52K probably damaging Het
Iqcc T C 4: 129,618,277 probably benign Het
Klra2 T A 6: 131,220,172 H288L probably benign Het
Myo5b T C 18: 74,638,153 probably null Het
Nisch A G 14: 31,176,465 probably benign Het
Nlrp4c A G 7: 6,066,825 N575S probably benign Het
Olfr354 A C 2: 36,906,965 R6S probably benign Het
Olfr913 A G 9: 38,594,841 I207V probably damaging Het
Phlda1 T A 10: 111,507,291 L296Q unknown Het
Rab36 G A 10: 75,051,005 E182K probably benign Het
Rasa3 G A 8: 13,570,368 T767M possibly damaging Het
Serpinb11 G A 1: 107,369,465 V24M probably damaging Het
Slc7a14 T G 3: 31,237,466 N221T probably damaging Het
Smg6 T C 11: 74,929,895 S331P possibly damaging Het
Snx1 C T 9: 66,097,436 A183T probably benign Het
Srpk2 T C 5: 23,524,517 T375A probably benign Het
Tecpr1 T C 5: 144,197,854 probably null Het
Topaz1 A T 9: 122,748,404 E126D probably benign Het
Ugt2b1 C G 5: 86,917,644 C512S possibly damaging Het
Ugt2b37 C T 5: 87,251,860 W263* probably null Het
Utp20 A T 10: 88,798,746 M750K possibly damaging Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp609 T C 9: 65,700,827 Y1257C probably damaging Het
Other mutations in Glmp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Glmp APN 3 88325862 unclassified probably null
IGL02551:Glmp APN 3 88325082 start codon destroyed probably null 0.53
IGL03212:Glmp APN 3 88328357 missense probably benign 0.01
R0325:Glmp UTSW 3 88325084 start codon destroyed probably null 0.72
R0719:Glmp UTSW 3 88326145 nonsense probably null
R0721:Glmp UTSW 3 88326145 nonsense probably null
R1617:Glmp UTSW 3 88328119 splice site probably benign
R1970:Glmp UTSW 3 88327870 missense probably damaging 1.00
R3824:Glmp UTSW 3 88326411 missense probably damaging 1.00
R3825:Glmp UTSW 3 88326411 missense probably damaging 1.00
R4521:Glmp UTSW 3 88328039 missense possibly damaging 0.60
R4697:Glmp UTSW 3 88328274 missense probably damaging 0.99
R4806:Glmp UTSW 3 88326013 intron probably benign
R4823:Glmp UTSW 3 88325223 intron probably benign
R5035:Glmp UTSW 3 88326644 splice site probably benign
R5335:Glmp UTSW 3 88326655 intron probably benign
R5592:Glmp UTSW 3 88326026 intron probably benign
R5738:Glmp UTSW 3 88326138 missense probably benign 0.06
R5921:Glmp UTSW 3 88325976 missense probably benign 0.09
R6046:Glmp UTSW 3 88325188 missense probably damaging 0.96
R6103:Glmp UTSW 3 88328031 missense probably benign 0.02
R6859:Glmp UTSW 3 88328042 missense probably benign 0.30
R6943:Glmp UTSW 3 88326610 missense probably damaging 1.00
R6945:Glmp UTSW 3 88325832 missense probably benign 0.02
R7204:Glmp UTSW 3 88326610 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCTCGTGGAAACCATTC -3'
(R):5'- GTGTTGTTAAATAAGAAATCCGGACC -3'

Sequencing Primer
(F):5'- AACCATTCCCTATTTGGTCTAGAGG -3'
(R):5'- ACCAGGAGGCTTACAGCTATTTG -3'
Posted On2016-06-15