Incidental Mutation 'R5043:Glmp'
ID 393288
Institutional Source Beutler Lab
Gene Symbol Glmp
Ensembl Gene ENSMUSG00000001418
Gene Name glycosylated lysosomal membrane protein
Synonyms 0610031J06Rik, NCU-G1
MMRRC Submission 042633-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5043 (G1)
Quality Score 83
Status Validated
Chromosome 3
Chromosomal Location 88232330-88235938 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to G at 88233983 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001452] [ENSMUST00000001454] [ENSMUST00000001456] [ENSMUST00000107552] [ENSMUST00000107553] [ENSMUST00000131666] [ENSMUST00000176425] [ENSMUST00000154381] [ENSMUST00000164166] [ENSMUST00000177005] [ENSMUST00000176519]
AlphaFold Q9JHJ3
Predicted Effect probably benign
Transcript: ENSMUST00000001452
SMART Domains Protein: ENSMUSP00000001452
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 33 527 3.2e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000001454
SMART Domains Protein: ENSMUSP00000001454
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 53 130 2.7e-26 PFAM
Pfam:NCU-G1 124 333 4.8e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000001456
SMART Domains Protein: ENSMUSP00000001456
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107552
SMART Domains Protein: ENSMUSP00000103176
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107553
SMART Domains Protein: ENSMUSP00000103177
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131666
SMART Domains Protein: ENSMUSP00000120235
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153716
Predicted Effect probably benign
Transcript: ENSMUST00000168971
SMART Domains Protein: ENSMUSP00000131250
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 38 5.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176425
SMART Domains Protein: ENSMUSP00000135575
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 37 314 3.3e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154381
SMART Domains Protein: ENSMUSP00000134809
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
Pfam:NCU-G1 2 72 5.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164166
SMART Domains Protein: ENSMUSP00000126109
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 15 489 1.7e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177005
SMART Domains Protein: ENSMUSP00000135398
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 54 397 1.1e-104 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176519
SMART Domains Protein: ENSMUSP00000135263
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 53 125 4.7e-26 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Homozygous mutants for this allele displayed spontaneous development of liver fibrosis at 6 months and various hepatic cell phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 144,980,910 (GRCm39) Y106* probably null Het
Acsbg3 A G 17: 57,192,198 (GRCm39) Y587C probably damaging Het
Akap12 G C 10: 4,305,047 (GRCm39) G619A probably damaging Het
Arhgap29 A G 3: 121,767,653 (GRCm39) K32E probably benign Het
Capg T A 6: 72,535,237 (GRCm39) Y253* probably null Het
Cntnap3 A T 13: 64,942,162 (GRCm39) F189L probably damaging Het
Cp T C 3: 20,028,081 (GRCm39) S496P probably benign Het
Cxcl11 T C 5: 92,511,011 (GRCm39) probably null Het
Dennd3 T C 15: 73,399,785 (GRCm39) L217P probably benign Het
Dip2c G T 13: 9,601,863 (GRCm39) R274L possibly damaging Het
Dnah12 C T 14: 26,606,147 (GRCm39) S3776L probably damaging Het
Emcn A G 3: 137,097,362 (GRCm39) T94A possibly damaging Het
Fnip2 A T 3: 79,400,174 (GRCm39) Y397* probably null Het
Gabrp T C 11: 33,518,072 (GRCm39) N79D probably benign Het
Gm5921 C T 9: 115,267,087 (GRCm39) noncoding transcript Het
Gm6483 A G 8: 19,743,686 (GRCm39) T104A probably benign Het
Ifi206 A T 1: 173,314,284 (GRCm39) M52K probably damaging Het
Iqcc T C 4: 129,512,070 (GRCm39) probably benign Het
Klra2 T A 6: 131,197,135 (GRCm39) H288L probably benign Het
Myo5b T C 18: 74,771,224 (GRCm39) probably null Het
Nisch A G 14: 30,898,422 (GRCm39) probably benign Het
Nlrp4c A G 7: 6,069,824 (GRCm39) N575S probably benign Het
Or1n2 A C 2: 36,796,977 (GRCm39) R6S probably benign Het
Or8b49 A G 9: 38,506,137 (GRCm39) I207V probably damaging Het
Phlda1 T A 10: 111,343,152 (GRCm39) L296Q unknown Het
Pramel19 T C 4: 101,797,721 (GRCm39) F40L possibly damaging Het
Rab36 G A 10: 74,886,837 (GRCm39) E182K probably benign Het
Rasa3 G A 8: 13,620,368 (GRCm39) T767M possibly damaging Het
Serpinb11 G A 1: 107,297,195 (GRCm39) V24M probably damaging Het
Slc7a14 T G 3: 31,291,615 (GRCm39) N221T probably damaging Het
Smg6 T C 11: 74,820,721 (GRCm39) S331P possibly damaging Het
Snx1 C T 9: 66,004,718 (GRCm39) A183T probably benign Het
Srpk2 T C 5: 23,729,515 (GRCm39) T375A probably benign Het
Tecpr1 T C 5: 144,134,672 (GRCm39) probably null Het
Topaz1 A T 9: 122,577,469 (GRCm39) E126D probably benign Het
Ugt2b1 C G 5: 87,065,503 (GRCm39) C512S possibly damaging Het
Ugt2b37 C T 5: 87,399,719 (GRCm39) W263* probably null Het
Utp20 A T 10: 88,634,608 (GRCm39) M750K possibly damaging Het
Yeats2 A T 16: 20,027,215 (GRCm39) Q822L probably damaging Het
Zfp609 T C 9: 65,608,109 (GRCm39) Y1257C probably damaging Het
Other mutations in Glmp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Glmp APN 3 88,233,169 (GRCm39) splice site probably null
IGL02551:Glmp APN 3 88,232,389 (GRCm39) start codon destroyed probably null 0.53
IGL03212:Glmp APN 3 88,235,664 (GRCm39) missense probably benign 0.01
R0325:Glmp UTSW 3 88,232,391 (GRCm39) start codon destroyed probably null 0.72
R0719:Glmp UTSW 3 88,233,452 (GRCm39) nonsense probably null
R0721:Glmp UTSW 3 88,233,452 (GRCm39) nonsense probably null
R1617:Glmp UTSW 3 88,235,426 (GRCm39) splice site probably benign
R1970:Glmp UTSW 3 88,235,177 (GRCm39) missense probably damaging 1.00
R3824:Glmp UTSW 3 88,233,718 (GRCm39) missense probably damaging 1.00
R3825:Glmp UTSW 3 88,233,718 (GRCm39) missense probably damaging 1.00
R4521:Glmp UTSW 3 88,235,346 (GRCm39) missense possibly damaging 0.60
R4697:Glmp UTSW 3 88,235,581 (GRCm39) missense probably damaging 0.99
R4806:Glmp UTSW 3 88,233,320 (GRCm39) intron probably benign
R4823:Glmp UTSW 3 88,232,530 (GRCm39) intron probably benign
R5035:Glmp UTSW 3 88,233,951 (GRCm39) splice site probably benign
R5335:Glmp UTSW 3 88,233,962 (GRCm39) intron probably benign
R5592:Glmp UTSW 3 88,233,333 (GRCm39) intron probably benign
R5738:Glmp UTSW 3 88,233,445 (GRCm39) missense probably benign 0.06
R5921:Glmp UTSW 3 88,233,283 (GRCm39) missense probably benign 0.09
R6046:Glmp UTSW 3 88,232,495 (GRCm39) missense probably damaging 0.96
R6103:Glmp UTSW 3 88,235,338 (GRCm39) missense probably benign 0.02
R6859:Glmp UTSW 3 88,235,349 (GRCm39) missense probably benign 0.30
R6943:Glmp UTSW 3 88,233,917 (GRCm39) missense probably damaging 1.00
R6945:Glmp UTSW 3 88,233,139 (GRCm39) missense probably benign 0.02
R7204:Glmp UTSW 3 88,233,917 (GRCm39) missense probably damaging 1.00
R7770:Glmp UTSW 3 88,233,077 (GRCm39) missense probably benign 0.39
R8022:Glmp UTSW 3 88,233,827 (GRCm39) missense probably damaging 1.00
R8079:Glmp UTSW 3 88,233,045 (GRCm39) missense probably damaging 0.98
R8296:Glmp UTSW 3 88,233,580 (GRCm39) missense probably benign 0.16
R8986:Glmp UTSW 3 88,233,002 (GRCm39) missense probably benign 0.28
R9266:Glmp UTSW 3 88,233,036 (GRCm39) missense probably damaging 0.98
R9335:Glmp UTSW 3 88,235,563 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTCCTCGTGGAAACCATTC -3'
(R):5'- GTGTTGTTAAATAAGAAATCCGGACC -3'

Sequencing Primer
(F):5'- AACCATTCCCTATTTGGTCTAGAGG -3'
(R):5'- ACCAGGAGGCTTACAGCTATTTG -3'
Posted On 2016-06-15