Mutagenetix > Incidental Mutation

Incidental Mutation 'R5043:Akap12'

393307

Institutional Source

Beutler Lab

Gene Symbol

Akap12

Ensembl Gene

ENSMUSG00000038587

Gene Name

A kinase (PRKA) anchor protein (gravin) 12

Synonyms

SSeCKS, Tsga12, Srcs5

MMRRC Submission

042633-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R5043 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4266380-4359470 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 4355047 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Alanine at position 619 (G619A)

Ref Sequence

ENSEMBL: ENSMUSP00000150261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045730] [ENSMUST00000215696]

AlphaFold

Q9WTQ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000045730
AA Change: G724A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035829
Gene: ENSMUSG00000038587
AA Change: G724A

Domain	Start	End	E-Value	Type
low complexity region	30	48	N/A	INTRINSIC
low complexity region	120	132	N/A	INTRINSIC
low complexity region	151	171	N/A	INTRINSIC
low complexity region	187	198	N/A	INTRINSIC
internal_repeat_1	212	279	3.2e-5	PROSPERO
coiled coil region	304	331	N/A	INTRINSIC
low complexity region	387	398	N/A	INTRINSIC
low complexity region	407	424	N/A	INTRINSIC
low complexity region	432	446	N/A	INTRINSIC
low complexity region	497	526	N/A	INTRINSIC
low complexity region	550	561	N/A	INTRINSIC
low complexity region	571	582	N/A	INTRINSIC
Pfam:WSK	591	619	2e-15	PFAM
low complexity region	626	637	N/A	INTRINSIC
low complexity region	673	684	N/A	INTRINSIC
low complexity region	700	711	N/A	INTRINSIC
Pfam:WSK	738	766	2.3e-15	PFAM
Pfam:WSK	779	807	6.2e-11	PFAM
low complexity region	951	973	N/A	INTRINSIC
low complexity region	1050	1065	N/A	INTRINSIC
low complexity region	1177	1187	N/A	INTRINSIC
internal_repeat_1	1197	1265	3.2e-5	PROSPERO
low complexity region	1303	1312	N/A	INTRINSIC
Pfam:RII_binding_1	1501	1518	4.2e-7	PFAM
coiled coil region	1651	1676	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000215696
AA Change: G619A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216139

Meta Mutation Damage Score

0.0917

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.4%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed in endothelial cells, cultured fibroblasts, and osteosarcoma cells. It associates with protein kinases A and C and phosphatase, and serves as a scaffold protein in signal transduction. This protein and RII PKA colocalize at the cell periphery. This protein is a cell growth-related protein. Antibodies to this protein can be produced by patients with myasthenia gravis. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele disrupting all three common isoforms suffer from prostatic hyperplasia and focal dysplasia, and from delayed fertility. Mice homozygous for a gene trap allele exhibit enhanced cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018F24Rik	T	A	5: 145,044,100	Y106*	probably null	Het
1700061G19Rik	A	G	17: 56,885,198	Y587C	probably damaging	Het
Arhgap29	A	G	3: 121,974,004	K32E	probably benign	Het
Capg	T	A	6: 72,558,254	Y253*	probably null	Het
Cntnap3	A	T	13: 64,794,348	F189L	probably damaging	Het
Cp	T	C	3: 19,973,917	S496P	probably benign	Het
Cxcl11	T	C	5: 92,363,152		probably null	Het
Dennd3	T	C	15: 73,527,936	L217P	probably benign	Het
Dip2c	G	T	13: 9,551,827	R274L	possibly damaging	Het
Dnah12	C	T	14: 26,884,190	S3776L	probably damaging	Het
Emcn	A	G	3: 137,391,601	T94A	possibly damaging	Het
Fnip2	A	T	3: 79,492,867	Y397*	probably null	Het
Gabrp	T	C	11: 33,568,072	N79D	probably benign	Het
Glmp	T	G	3: 88,326,676		probably benign	Het
Gm12794	T	C	4: 101,940,524	F40L	possibly damaging	Het
Gm5921	C	T	9: 115,438,019		noncoding transcript	Het
Gm6483	A	G	8: 19,693,670	T104A	probably benign	Het
Ifi206	A	T	1: 173,486,718	M52K	probably damaging	Het
Iqcc	T	C	4: 129,618,277		probably benign	Het
Klra2	T	A	6: 131,220,172	H288L	probably benign	Het
Myo5b	T	C	18: 74,638,153		probably null	Het
Nisch	A	G	14: 31,176,465		probably benign	Het
Nlrp4c	A	G	7: 6,066,825	N575S	probably benign	Het
Olfr354	A	C	2: 36,906,965	R6S	probably benign	Het
Olfr913	A	G	9: 38,594,841	I207V	probably damaging	Het
Phlda1	T	A	10: 111,507,291	L296Q	unknown	Het
Rab36	G	A	10: 75,051,005	E182K	probably benign	Het
Rasa3	G	A	8: 13,570,368	T767M	possibly damaging	Het
Serpinb11	G	A	1: 107,369,465	V24M	probably damaging	Het
Slc7a14	T	G	3: 31,237,466	N221T	probably damaging	Het
Smg6	T	C	11: 74,929,895	S331P	possibly damaging	Het
Snx1	C	T	9: 66,097,436	A183T	probably benign	Het
Srpk2	T	C	5: 23,524,517	T375A	probably benign	Het
Tecpr1	T	C	5: 144,197,854		probably null	Het
Topaz1	A	T	9: 122,748,404	E126D	probably benign	Het
Ugt2b1	C	G	5: 86,917,644	C512S	possibly damaging	Het
Ugt2b37	C	T	5: 87,251,860	W263*	probably null	Het
Utp20	A	T	10: 88,798,746	M750K	possibly damaging	Het
Yeats2	A	T	16: 20,208,465	Q822L	probably damaging	Het
Zfp609	T	C	9: 65,700,827	Y1257C	probably damaging	Het

Other mutations in Akap12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00712:Akap12	APN	10	4357164	missense	probably benign	0.09
IGL01306:Akap12	APN	10	4353273	missense	probably benign	0.04
IGL01360:Akap12	APN	10	4357537	missense	probably benign	0.02
IGL01455:Akap12	APN	10	4356886	missense	probably damaging	0.99
IGL01458:Akap12	APN	10	4354060	missense	probably damaging	1.00
IGL01465:Akap12	APN	10	4356886	missense	probably damaging	0.99
IGL02348:Akap12	APN	10	4354722	missense	probably damaging	1.00
IGL02425:Akap12	APN	10	4356034	missense	possibly damaging	0.67
IGL02502:Akap12	APN	10	4353163	missense	probably damaging	1.00
IGL02736:Akap12	APN	10	4355637	missense	probably benign
IGL02969:Akap12	APN	10	4354864	missense	probably damaging	1.00
IGL03345:Akap12	APN	10	4356697	missense	probably benign	0.42
ANU23:Akap12	UTSW	10	4353273	missense	probably benign	0.04
FR4976:Akap12	UTSW	10	4353837	small insertion	probably benign
R0004:Akap12	UTSW	10	4353218	missense	possibly damaging	0.56
R0004:Akap12	UTSW	10	4353220	missense	probably damaging	1.00
R0207:Akap12	UTSW	10	4353333	missense	probably damaging	1.00
R0580:Akap12	UTSW	10	4354741	missense	possibly damaging	0.91
R0675:Akap12	UTSW	10	4353315	missense	probably benign	0.06
R1248:Akap12	UTSW	10	4353847	missense	probably benign	0.11
R1338:Akap12	UTSW	10	4313773	missense	possibly damaging	0.95
R1448:Akap12	UTSW	10	4355475	missense	probably benign	0.22
R1458:Akap12	UTSW	10	4353693	missense	probably damaging	1.00
R1521:Akap12	UTSW	10	4354804	missense	probably benign	0.02
R1585:Akap12	UTSW	10	4353640	missense	probably benign	0.11
R1725:Akap12	UTSW	10	4353942	missense	probably damaging	1.00
R1756:Akap12	UTSW	10	4357574	missense	probably benign	0.04
R1914:Akap12	UTSW	10	4356685	missense	probably benign	0.01
R1978:Akap12	UTSW	10	4313855	missense	probably benign	0.06
R2032:Akap12	UTSW	10	4356673	missense	possibly damaging	0.50
R2041:Akap12	UTSW	10	4356489	missense	probably benign	0.01
R3009:Akap12	UTSW	10	4357891	missense	probably benign	0.06
R3872:Akap12	UTSW	10	4357590	missense	probably benign	0.00
R3874:Akap12	UTSW	10	4357590	missense	probably benign	0.00
R3875:Akap12	UTSW	10	4357590	missense	probably benign	0.00
R3944:Akap12	UTSW	10	4357347	missense	probably benign	0.00
R4612:Akap12	UTSW	10	4354456	missense	probably damaging	1.00
R4889:Akap12	UTSW	10	4356535	missense	probably damaging	0.97
R5176:Akap12	UTSW	10	4353947	missense	probably benign	0.19
R5278:Akap12	UTSW	10	4354792	missense	probably benign	0.02
R5320:Akap12	UTSW	10	4357291	missense	probably benign	0.00
R5443:Akap12	UTSW	10	4355576	missense	probably damaging	1.00
R5533:Akap12	UTSW	10	4357405	missense	probably damaging	1.00
R6133:Akap12	UTSW	10	4355178	missense	probably benign	0.05
R6142:Akap12	UTSW	10	4313740	splice site	probably null
R6190:Akap12	UTSW	10	4356268	missense	possibly damaging	0.92
R6458:Akap12	UTSW	10	4355148	missense	probably damaging	1.00
R6562:Akap12	UTSW	10	4356141	nonsense	probably null
R6701:Akap12	UTSW	10	4355243	missense	probably damaging	1.00
R6828:Akap12	UTSW	10	4354606	missense	probably damaging	0.96
R6991:Akap12	UTSW	10	4357122	nonsense	probably null
R7023:Akap12	UTSW	10	4356895	missense	probably benign	0.05
R7102:Akap12	UTSW	10	4353226	missense	probably damaging	1.00
R7483:Akap12	UTSW	10	4353967	missense	probably benign	0.00
R7538:Akap12	UTSW	10	4353213	missense	probably damaging	1.00
R7664:Akap12	UTSW	10	4353748	missense	probably damaging	1.00
R7704:Akap12	UTSW	10	4356082	missense	probably damaging	1.00
R8447:Akap12	UTSW	10	4356289	missense	probably benign	0.32
R8502:Akap12	UTSW	10	4313856	missense	probably benign	0.22
R8910:Akap12	UTSW	10	4313822	missense	probably benign
R8946:Akap12	UTSW	10	4354368	missense	probably damaging	1.00
R9003:Akap12	UTSW	10	4356744	missense	probably benign	0.32
R9237:Akap12	UTSW	10	4357231	missense	probably benign
R9347:Akap12	UTSW	10	4353640	missense	probably benign	0.11
R9428:Akap12	UTSW	10	4353409	missense	probably damaging	1.00
R9734:Akap12	UTSW	10	4355929	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTCAGTGTCTTGGGAGGC -3'
(R):5'- CCGCCGTCCAGGAATAAATTTC -3'

Sequencing Primer
(F):5'- CGTTGATTTGTGTCGGATCGTCC -3'
(R):5'- GGAAACCCAAGATTCCTCTCTACTTG -3'

Posted On

2016-06-15