Incidental Mutation 'R0445:Slc4a1'
ID39331
Institutional Source Beutler Lab
Gene Symbol Slc4a1
Ensembl Gene ENSMUSG00000006574
Gene Namesolute carrier family 4 (anion exchanger), member 1
SynonymsAe1, CD233, l11Jus51, band 3, Empb3, erythrocyte membrane protein band 3
MMRRC Submission 038646-MU
Accession Numbers

Genbank: NM_011403; MGI: 109393

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0445 (G1)
Quality Score140
Status Validated
Chromosome11
Chromosomal Location102348824-102366203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102354366 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 585 (V585A)
Ref Sequence ENSEMBL: ENSMUSP00000006749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006749]
Predicted Effect probably benign
Transcript: ENSMUST00000006749
AA Change: V585A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000006749
Gene: ENSMUSG00000006574
AA Change: V585A

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Pfam:Band_3_cyto 100 342 1.6e-81 PFAM
Pfam:HCO3_cotransp 391 584 5.7e-85 PFAM
Pfam:HCO3_cotransp 575 857 5.6e-118 PFAM
transmembrane domain 875 892 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149993
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the anion exchanger (AE) family and is expressed in the erythrocyte plasma membrane, where it functions as a chloride/bicarbonate exchanger involved in carbon dioxide transport from tissues to lungs. The protein comprises two domains that are structurally and functionally distinct. The N-terminal 40kDa domain is located in the cytoplasm and acts as an attachment site for the red cell skeleton by binding ankyrin. The glycosylated C-terminal membrane-associated domain contains 12-14 membrane spanning segments and carries out the stilbene disulphonate-sensitive exchange transport of anions. The cytoplasmic tail at the extreme C-terminus of the membrane domain binds carbonic anhydrase II. The encoded protein associates with the red cell membrane protein glycophorin A and this association promotes the correct folding and translocation of the exchanger. This protein is predominantly dimeric but forms tetramers in the presence of ankyrin. Many mutations in this gene are known in man, and these mutations can lead to two types of disease: destabilization of red cell membrane leading to hereditary spherocytosis, and defective kidney acid secretion leading to distal renal tubular acidosis. Other mutations that do not give rise to disease result in novel blood group antigens, which form the Diego blood group system. Southeast Asian ovalocytosis (SAO, Melanesian ovalocytosis) results from the heterozygous presence of a deletion in the encoded protein and is common in areas where Plasmodium falciparum malaria is endemic. One null mutation in this gene is known, resulting in very severe anemia and nephrocalcinosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations exhibit retarded growth, severe spherocytosis, hemolytic anemia, lack of erythrocyte glycophorin A, mitotic defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Targeted, other(1) Spontaneous(1) Chemically induced(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A C 17: 48,090,022 probably null Het
4932438A13Rik T C 3: 37,000,065 V3111A probably damaging Het
A2m C T 6: 121,657,955 T687I probably damaging Het
Acsbg1 A G 9: 54,615,895 S483P probably damaging Het
Adam22 T A 5: 8,180,591 probably benign Het
Aggf1 A G 13: 95,354,001 V595A possibly damaging Het
Aplf A T 6: 87,663,752 L71I probably damaging Het
Arid3c G T 4: 41,725,172 P292T probably benign Het
Brms1l T A 12: 55,861,406 Y213* probably null Het
C87436 T A 6: 86,449,850 S332T possibly damaging Het
Cad G A 5: 31,072,709 A1454T probably benign Het
Cdkn3 T C 14: 46,767,400 probably null Het
Cnot1 A G 8: 95,760,208 C624R probably damaging Het
Cntnap5c A T 17: 58,104,743 I541F probably benign Het
Cyhr1 T C 15: 76,648,257 H217R probably damaging Het
Dennd1b A G 1: 139,167,765 probably benign Het
Dscam A T 16: 96,772,503 I753N probably damaging Het
Eef2 C CN 10: 81,178,770 probably null Het
Epg5 T A 18: 78,014,184 V1826D possibly damaging Het
Epha8 T C 4: 136,932,400 Y755C probably damaging Het
Esco1 A T 18: 10,574,989 N694K probably damaging Het
Fermt3 T C 19: 7,003,299 H300R probably benign Het
Galnt5 C A 2: 57,998,950 F187L probably benign Het
Gm17067 A G 7: 42,708,622 I152T probably benign Het
Gnb3 T C 6: 124,837,255 D154G possibly damaging Het
Gpr155 G A 2: 73,370,144 probably benign Het
Hdac3 A G 18: 37,943,724 I240T probably damaging Het
Ifitm1 A T 7: 140,968,441 probably null Het
Kif1b A T 4: 149,188,009 L1455Q probably benign Het
Krt1 A C 15: 101,847,621 L388R probably damaging Het
Lrp1 T A 10: 127,590,636 K635* probably null Het
Map3k2 A G 18: 32,217,210 Y371C probably damaging Het
Mcu T C 10: 59,456,645 probably benign Het
Mkrn1 C T 6: 39,404,854 V167I probably benign Het
Mrpl9 T A 3: 94,444,891 probably benign Het
Naip2 T C 13: 100,161,887 Y547C possibly damaging Het
Nup88 G A 11: 70,947,729 T487I probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Obscn C T 11: 58,999,335 R7457H unknown Het
Olfr1383 T A 11: 49,523,957 V78E probably damaging Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Paf1 T C 7: 28,395,688 S118P probably damaging Het
Parp4 T A 14: 56,602,748 probably null Het
Pcdh15 A T 10: 74,342,549 Y157F probably damaging Het
Pex10 G A 4: 155,069,074 probably null Het
Phrf1 C T 7: 141,247,331 probably benign Het
Polr3a G T 14: 24,454,921 D1090E probably benign Het
Ppfia4 A C 1: 134,327,289 L276R probably benign Het
Rdh16f1 T C 10: 127,790,867 L263S probably benign Het
Ryr3 T C 2: 112,866,054 D967G probably benign Het
Shc1 G T 3: 89,426,537 A226S probably damaging Het
Stk38l T A 6: 146,775,686 S461T probably benign Het
Tbkbp1 A T 11: 97,149,469 S40T probably damaging Het
Tet1 A G 10: 62,879,941 M25T probably benign Het
Themis A G 10: 28,782,011 R192G probably damaging Het
Tmem144 T C 3: 79,825,354 T206A probably benign Het
Tmem74b G A 2: 151,706,959 R202H probably damaging Het
Trpm1 T C 7: 64,244,842 probably benign Het
Vars A G 17: 35,011,809 H557R probably benign Het
Zbtb12 C A 17: 34,896,301 A354E possibly damaging Het
Zfp143 A T 7: 110,061,117 probably benign Het
Other mutations in Slc4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Slc4a1 APN 11 102357964 missense probably benign 0.09
IGL01845:Slc4a1 APN 11 102353903 missense probably benign 0.01
IGL02166:Slc4a1 APN 11 102354333 missense probably damaging 1.00
IGL02745:Slc4a1 APN 11 102356267 missense probably damaging 1.00
IGL02801:Slc4a1 APN 11 102359146 critical splice acceptor site probably null
Rumor UTSW 11 102361222 nonsense probably null
A5278:Slc4a1 UTSW 11 102353815 splice site probably benign
R0011:Slc4a1 UTSW 11 102357110 missense possibly damaging 0.51
R0193:Slc4a1 UTSW 11 102352684 missense possibly damaging 0.91
R0599:Slc4a1 UTSW 11 102357915 splice site probably benign
R0635:Slc4a1 UTSW 11 102352672 missense possibly damaging 0.78
R1496:Slc4a1 UTSW 11 102361171 missense probably benign
R1816:Slc4a1 UTSW 11 102351230 missense probably damaging 1.00
R1898:Slc4a1 UTSW 11 102350307 missense probably damaging 1.00
R2361:Slc4a1 UTSW 11 102356830 missense probably damaging 1.00
R2381:Slc4a1 UTSW 11 102359302 missense probably benign 0.00
R3806:Slc4a1 UTSW 11 102357193 missense probably benign 0.00
R3857:Slc4a1 UTSW 11 102357121 missense probably benign 0.01
R3858:Slc4a1 UTSW 11 102357121 missense probably benign 0.01
R4585:Slc4a1 UTSW 11 102361419 utr 5 prime probably benign
R4586:Slc4a1 UTSW 11 102361419 utr 5 prime probably benign
R4705:Slc4a1 UTSW 11 102356258 missense possibly damaging 0.89
R4914:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R4915:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R4916:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R4918:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R5001:Slc4a1 UTSW 11 102351503 missense probably benign 0.12
R5103:Slc4a1 UTSW 11 102353261 missense possibly damaging 0.65
R5234:Slc4a1 UTSW 11 102361383 missense probably benign 0.03
R5308:Slc4a1 UTSW 11 102359077 missense probably damaging 0.98
R5315:Slc4a1 UTSW 11 102358254 missense possibly damaging 0.77
R5478:Slc4a1 UTSW 11 102350314 missense probably damaging 0.98
R5521:Slc4a1 UTSW 11 102353266 missense probably benign 0.01
R5888:Slc4a1 UTSW 11 102356525 missense probably damaging 0.98
R6011:Slc4a1 UTSW 11 102352531 missense probably damaging 1.00
R6547:Slc4a1 UTSW 11 102356735 missense probably damaging 0.99
R6629:Slc4a1 UTSW 11 102361222 nonsense probably null
R6717:Slc4a1 UTSW 11 102354423 missense probably damaging 0.99
R7051:Slc4a1 UTSW 11 102356258 missense probably benign 0.12
R7103:Slc4a1 UTSW 11 102353867 missense probably damaging 0.97
R7315:Slc4a1 UTSW 11 102356484 missense probably damaging 1.00
R7331:Slc4a1 UTSW 11 102361419 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTTGATGAAGGAATCCACCAGGACC -3'
(R):5'- ACAACTGATTGATAGTGCCCAGTCAAC -3'

Sequencing Primer
(F):5'- TGCAACATGGTCCCTGGAAG -3'
(R):5'- GATAGTGCCCAGTCAACTTATTTG -3'
Posted On2013-05-23