Incidental Mutation 'R5043:Gabrp'
ID393311
Institutional Source Beutler Lab
Gene Symbol Gabrp
Ensembl Gene ENSMUSG00000020159
Gene Namegamma-aminobutyric acid (GABA) A receptor, pi
Synonyms
MMRRC Submission 042633-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5043 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location33550781-33578959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33568072 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 79 (N79D)
Ref Sequence ENSEMBL: ENSMUSP00000020366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020366] [ENSMUST00000135350]
Predicted Effect probably benign
Transcript: ENSMUST00000020366
AA Change: N79D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000020366
Gene: ENSMUSG00000020159
AA Change: N79D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Neur_chan_LBD 40 242 1.3e-49 PFAM
Pfam:Neur_chan_memb 249 353 5.2e-23 PFAM
transmembrane domain 420 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135350
SMART Domains Protein: ENSMUSP00000120500
Gene: ENSMUSG00000020159

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. The subunit encoded by this gene is expressed in several non-neuronal tissues including the uterus and ovaries. This subunit can assemble with known GABA A receptor subunits, and the presence of this subunit alters the sensitivity of recombinant receptors to modulatory agents such as pregnanolone. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,044,100 Y106* probably null Het
1700061G19Rik A G 17: 56,885,198 Y587C probably damaging Het
Akap12 G C 10: 4,355,047 G619A probably damaging Het
Arhgap29 A G 3: 121,974,004 K32E probably benign Het
Capg T A 6: 72,558,254 Y253* probably null Het
Cntnap3 A T 13: 64,794,348 F189L probably damaging Het
Cp T C 3: 19,973,917 S496P probably benign Het
Cxcl11 T C 5: 92,363,152 probably null Het
Dennd3 T C 15: 73,527,936 L217P probably benign Het
Dip2c G T 13: 9,551,827 R274L possibly damaging Het
Dnah12 C T 14: 26,884,190 S3776L probably damaging Het
Emcn A G 3: 137,391,601 T94A possibly damaging Het
Fnip2 A T 3: 79,492,867 Y397* probably null Het
Glmp T G 3: 88,326,676 probably benign Het
Gm12794 T C 4: 101,940,524 F40L possibly damaging Het
Gm5921 C T 9: 115,438,019 noncoding transcript Het
Gm6483 A G 8: 19,693,670 T104A probably benign Het
Ifi206 A T 1: 173,486,718 M52K probably damaging Het
Iqcc T C 4: 129,618,277 probably benign Het
Klra2 T A 6: 131,220,172 H288L probably benign Het
Myo5b T C 18: 74,638,153 probably null Het
Nisch A G 14: 31,176,465 probably benign Het
Nlrp4c A G 7: 6,066,825 N575S probably benign Het
Olfr354 A C 2: 36,906,965 R6S probably benign Het
Olfr913 A G 9: 38,594,841 I207V probably damaging Het
Phlda1 T A 10: 111,507,291 L296Q unknown Het
Rab36 G A 10: 75,051,005 E182K probably benign Het
Rasa3 G A 8: 13,570,368 T767M possibly damaging Het
Serpinb11 G A 1: 107,369,465 V24M probably damaging Het
Slc7a14 T G 3: 31,237,466 N221T probably damaging Het
Smg6 T C 11: 74,929,895 S331P possibly damaging Het
Snx1 C T 9: 66,097,436 A183T probably benign Het
Srpk2 T C 5: 23,524,517 T375A probably benign Het
Tecpr1 T C 5: 144,197,854 probably null Het
Topaz1 A T 9: 122,748,404 E126D probably benign Het
Ugt2b1 C G 5: 86,917,644 C512S possibly damaging Het
Ugt2b37 C T 5: 87,251,860 W263* probably null Het
Utp20 A T 10: 88,798,746 M750K possibly damaging Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp609 T C 9: 65,700,827 Y1257C probably damaging Het
Other mutations in Gabrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Gabrp APN 11 33552644 missense possibly damaging 0.91
IGL01299:Gabrp APN 11 33554476 missense probably damaging 1.00
IGL01305:Gabrp APN 11 33555055 missense probably damaging 1.00
IGL01686:Gabrp APN 11 33552826 nonsense probably null
IGL01729:Gabrp APN 11 33552689 missense probably damaging 1.00
IGL03031:Gabrp APN 11 33554980 missense probably damaging 1.00
IGL03172:Gabrp APN 11 33554388 missense probably damaging 1.00
IGL03280:Gabrp APN 11 33552616 missense probably benign 0.12
ANU22:Gabrp UTSW 11 33555055 missense probably damaging 1.00
R0265:Gabrp UTSW 11 33552614 missense probably damaging 1.00
R0326:Gabrp UTSW 11 33554362 missense probably damaging 0.99
R1744:Gabrp UTSW 11 33572462 missense probably benign 0.03
R4174:Gabrp UTSW 11 33568092 missense probably damaging 1.00
R5213:Gabrp UTSW 11 33567211 critical splice donor site probably null
R5290:Gabrp UTSW 11 33567310 missense probably damaging 0.99
R5665:Gabrp UTSW 11 33554308 missense possibly damaging 0.56
R6698:Gabrp UTSW 11 33557017 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTCAATCGGTCACTTCC -3'
(R):5'- ATGTAGATACACCGGCTGCG -3'

Sequencing Primer
(F):5'- AGTCAATCGGTCACTTCCTTTTCTAC -3'
(R):5'- TTCTCAGGTGACCCAGTT -3'
Posted On2016-06-15