Incidental Mutation 'R5043:Dennd3'
ID393317
Institutional Source Beutler Lab
Gene Symbol Dennd3
Ensembl Gene ENSMUSG00000036661
Gene NameDENN/MADD domain containing 3
SynonymsE030003N15Rik
MMRRC Submission 042633-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R5043 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location73512560-73572242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73527936 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 217 (L217P)
Ref Sequence ENSEMBL: ENSMUSP00000134002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043414] [ENSMUST00000173292]
Predicted Effect probably benign
Transcript: ENSMUST00000043414
AA Change: L217P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000046774
Gene: ENSMUSG00000036661
AA Change: L217P

DomainStartEndE-ValueType
Blast:uDENN 12 161 3e-78 BLAST
DENN 187 373 1.54e-62 SMART
dDENN 436 499 6.81e-14 SMART
WD40 1015 1054 3.68e1 SMART
WD40 1057 1098 3.32e-5 SMART
WD40 1232 1272 1.1e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162488
SMART Domains Protein: ENSMUSP00000125657
Gene: ENSMUSG00000036661

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Blast:DENN 33 104 5e-28 BLAST
DENN 116 302 1.54e-62 SMART
dDENN 312 376 5.63e-6 SMART
WD40 892 931 3.68e1 SMART
WD40 934 975 3.32e-5 SMART
WD40 1109 1149 1.1e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162824
Predicted Effect probably benign
Transcript: ENSMUST00000173292
AA Change: L217P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000134002
Gene: ENSMUSG00000036661
AA Change: L217P

DomainStartEndE-ValueType
Blast:uDENN 12 161 2e-78 BLAST
DENN 187 373 1.54e-62 SMART
dDENN 436 499 6.81e-14 SMART
WD40 1015 1054 3.68e1 SMART
WD40 1057 1098 3.32e-5 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,044,100 Y106* probably null Het
1700061G19Rik A G 17: 56,885,198 Y587C probably damaging Het
Akap12 G C 10: 4,355,047 G619A probably damaging Het
Arhgap29 A G 3: 121,974,004 K32E probably benign Het
Capg T A 6: 72,558,254 Y253* probably null Het
Cntnap3 A T 13: 64,794,348 F189L probably damaging Het
Cp T C 3: 19,973,917 S496P probably benign Het
Cxcl11 T C 5: 92,363,152 probably null Het
Dip2c G T 13: 9,551,827 R274L possibly damaging Het
Dnah12 C T 14: 26,884,190 S3776L probably damaging Het
Emcn A G 3: 137,391,601 T94A possibly damaging Het
Fnip2 A T 3: 79,492,867 Y397* probably null Het
Gabrp T C 11: 33,568,072 N79D probably benign Het
Glmp T G 3: 88,326,676 probably benign Het
Gm12794 T C 4: 101,940,524 F40L possibly damaging Het
Gm5921 C T 9: 115,438,019 noncoding transcript Het
Gm6483 A G 8: 19,693,670 T104A probably benign Het
Ifi206 A T 1: 173,486,718 M52K probably damaging Het
Iqcc T C 4: 129,618,277 probably benign Het
Klra2 T A 6: 131,220,172 H288L probably benign Het
Myo5b T C 18: 74,638,153 probably null Het
Nisch A G 14: 31,176,465 probably benign Het
Nlrp4c A G 7: 6,066,825 N575S probably benign Het
Olfr354 A C 2: 36,906,965 R6S probably benign Het
Olfr913 A G 9: 38,594,841 I207V probably damaging Het
Phlda1 T A 10: 111,507,291 L296Q unknown Het
Rab36 G A 10: 75,051,005 E182K probably benign Het
Rasa3 G A 8: 13,570,368 T767M possibly damaging Het
Serpinb11 G A 1: 107,369,465 V24M probably damaging Het
Slc7a14 T G 3: 31,237,466 N221T probably damaging Het
Smg6 T C 11: 74,929,895 S331P possibly damaging Het
Snx1 C T 9: 66,097,436 A183T probably benign Het
Srpk2 T C 5: 23,524,517 T375A probably benign Het
Tecpr1 T C 5: 144,197,854 probably null Het
Topaz1 A T 9: 122,748,404 E126D probably benign Het
Ugt2b1 C G 5: 86,917,644 C512S possibly damaging Het
Ugt2b37 C T 5: 87,251,860 W263* probably null Het
Utp20 A T 10: 88,798,746 M750K possibly damaging Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp609 T C 9: 65,700,827 Y1257C probably damaging Het
Other mutations in Dennd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dennd3 APN 15 73567133 missense probably benign 0.26
IGL00579:Dennd3 APN 15 73540842 missense possibly damaging 0.63
IGL02101:Dennd3 APN 15 73527945 missense possibly damaging 0.81
IGL02164:Dennd3 APN 15 73544448 missense probably benign 0.26
IGL02389:Dennd3 APN 15 73567056 missense probably damaging 1.00
IGL02604:Dennd3 APN 15 73556403 missense probably damaging 1.00
IGL02697:Dennd3 APN 15 73524236 missense possibly damaging 0.82
IGL02885:Dennd3 APN 15 73568696 missense probably benign
IGL03356:Dennd3 APN 15 73568633 missense probably benign 0.19
IGL03388:Dennd3 APN 15 73544359 missense probably damaging 0.98
BB006:Dennd3 UTSW 15 73564574 missense probably damaging 1.00
BB016:Dennd3 UTSW 15 73564574 missense probably damaging 1.00
R0118:Dennd3 UTSW 15 73565076 missense probably damaging 1.00
R0925:Dennd3 UTSW 15 73533435 missense probably damaging 1.00
R1076:Dennd3 UTSW 15 73540733 missense probably damaging 1.00
R1355:Dennd3 UTSW 15 73540854 splice site probably benign
R1370:Dennd3 UTSW 15 73540854 splice site probably benign
R1480:Dennd3 UTSW 15 73532846 missense probably benign 0.20
R1727:Dennd3 UTSW 15 73565128 missense possibly damaging 0.95
R1732:Dennd3 UTSW 15 73537418 splice site probably benign
R1771:Dennd3 UTSW 15 73555101 missense possibly damaging 0.71
R1776:Dennd3 UTSW 15 73555101 missense possibly damaging 0.71
R1779:Dennd3 UTSW 15 73522508 critical splice donor site probably null
R1838:Dennd3 UTSW 15 73565100 missense probably damaging 1.00
R2146:Dennd3 UTSW 15 73523496 missense probably damaging 1.00
R2146:Dennd3 UTSW 15 73555060 missense probably benign 0.35
R2147:Dennd3 UTSW 15 73523487 missense probably damaging 1.00
R2148:Dennd3 UTSW 15 73555060 missense probably benign 0.35
R2149:Dennd3 UTSW 15 73555060 missense probably benign 0.35
R2150:Dennd3 UTSW 15 73555060 missense probably benign 0.35
R2174:Dennd3 UTSW 15 73555305 missense probably damaging 1.00
R2295:Dennd3 UTSW 15 73523555 critical splice donor site probably null
R2905:Dennd3 UTSW 15 73557646 missense probably damaging 1.00
R3106:Dennd3 UTSW 15 73565124 nonsense probably null
R3757:Dennd3 UTSW 15 73522234 missense probably benign 0.00
R3785:Dennd3 UTSW 15 73547577 missense possibly damaging 0.89
R3786:Dennd3 UTSW 15 73547577 missense possibly damaging 0.89
R3787:Dennd3 UTSW 15 73547577 missense possibly damaging 0.89
R3847:Dennd3 UTSW 15 73542732 missense possibly damaging 0.64
R4369:Dennd3 UTSW 15 73540809 missense probably damaging 0.98
R4601:Dennd3 UTSW 15 73567160 missense probably damaging 0.99
R4666:Dennd3 UTSW 15 73570860 missense probably damaging 1.00
R4680:Dennd3 UTSW 15 73533376 missense possibly damaging 0.82
R4708:Dennd3 UTSW 15 73523495 missense probably damaging 1.00
R4789:Dennd3 UTSW 15 73522282 missense probably damaging 1.00
R4920:Dennd3 UTSW 15 73540725 missense probably benign 0.13
R5074:Dennd3 UTSW 15 73547295 missense probably damaging 1.00
R5410:Dennd3 UTSW 15 73547448 missense probably benign 0.02
R5421:Dennd3 UTSW 15 73567115 missense probably benign
R5560:Dennd3 UTSW 15 73532895 missense probably damaging 1.00
R6008:Dennd3 UTSW 15 73567080 missense possibly damaging 0.88
R6357:Dennd3 UTSW 15 73556472 missense possibly damaging 0.49
R6563:Dennd3 UTSW 15 73544380 missense probably damaging 0.98
R6687:Dennd3 UTSW 15 73556366 missense possibly damaging 0.64
R6837:Dennd3 UTSW 15 73557693 missense probably damaging 1.00
R6910:Dennd3 UTSW 15 73555116 missense probably benign 0.01
R7125:Dennd3 UTSW 15 73533291 missense possibly damaging 0.50
R7297:Dennd3 UTSW 15 73557610 missense probably damaging 1.00
R7524:Dennd3 UTSW 15 73524246 nonsense probably null
R7580:Dennd3 UTSW 15 73556447 missense possibly damaging 0.89
R7653:Dennd3 UTSW 15 73562426 missense probably damaging 0.99
R7731:Dennd3 UTSW 15 73562367 missense probably damaging 0.99
R7767:Dennd3 UTSW 15 73522230 missense probably benign
R7806:Dennd3 UTSW 15 73570775 missense possibly damaging 0.87
R7860:Dennd3 UTSW 15 73540808 missense probably damaging 0.97
R7902:Dennd3 UTSW 15 73568115 critical splice donor site probably benign
R7929:Dennd3 UTSW 15 73564574 missense probably damaging 1.00
R8218:Dennd3 UTSW 15 73512773 missense probably benign 0.31
R8436:Dennd3 UTSW 15 73562349 missense probably damaging 1.00
R8444:Dennd3 UTSW 15 73570823 missense probably benign 0.09
RF006:Dennd3 UTSW 15 73547592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATGCACTTCAGAATGTCATG -3'
(R):5'- TCTGGAGAGCAGGCTAAACATG -3'

Sequencing Primer
(F):5'- ATGTTTCTCACGGAAGCGTAC -3'
(R):5'- GGCTGAAACCTGAAACAGTTTC -3'
Posted On2016-06-15