Incidental Mutation 'R5043:1700061G19Rik'
ID393320
Institutional Source Beutler Lab
Gene Symbol 1700061G19Rik
Ensembl Gene ENSMUSG00000024209
Gene NameRIKEN cDNA 1700061G19 gene
Synonyms
MMRRC Submission 042633-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5043 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location56875477-56888904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56885198 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 587 (Y587C)
Ref Sequence ENSEMBL: ENSMUSP00000025048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025048]
Predicted Effect probably damaging
Transcript: ENSMUST00000025048
AA Change: Y587C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025048
Gene: ENSMUSG00000024209
AA Change: Y587C

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Pfam:AMP-binding 80 554 6.5e-68 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,044,100 Y106* probably null Het
Akap12 G C 10: 4,355,047 G619A probably damaging Het
Arhgap29 A G 3: 121,974,004 K32E probably benign Het
Capg T A 6: 72,558,254 Y253* probably null Het
Cntnap3 A T 13: 64,794,348 F189L probably damaging Het
Cp T C 3: 19,973,917 S496P probably benign Het
Cxcl11 T C 5: 92,363,152 probably null Het
Dennd3 T C 15: 73,527,936 L217P probably benign Het
Dip2c G T 13: 9,551,827 R274L possibly damaging Het
Dnah12 C T 14: 26,884,190 S3776L probably damaging Het
Emcn A G 3: 137,391,601 T94A possibly damaging Het
Fnip2 A T 3: 79,492,867 Y397* probably null Het
Gabrp T C 11: 33,568,072 N79D probably benign Het
Glmp T G 3: 88,326,676 probably benign Het
Gm12794 T C 4: 101,940,524 F40L possibly damaging Het
Gm5921 C T 9: 115,438,019 noncoding transcript Het
Gm6483 A G 8: 19,693,670 T104A probably benign Het
Ifi206 A T 1: 173,486,718 M52K probably damaging Het
Iqcc T C 4: 129,618,277 probably benign Het
Klra2 T A 6: 131,220,172 H288L probably benign Het
Myo5b T C 18: 74,638,153 probably null Het
Nisch A G 14: 31,176,465 probably benign Het
Nlrp4c A G 7: 6,066,825 N575S probably benign Het
Olfr354 A C 2: 36,906,965 R6S probably benign Het
Olfr913 A G 9: 38,594,841 I207V probably damaging Het
Phlda1 T A 10: 111,507,291 L296Q unknown Het
Rab36 G A 10: 75,051,005 E182K probably benign Het
Rasa3 G A 8: 13,570,368 T767M possibly damaging Het
Serpinb11 G A 1: 107,369,465 V24M probably damaging Het
Slc7a14 T G 3: 31,237,466 N221T probably damaging Het
Smg6 T C 11: 74,929,895 S331P possibly damaging Het
Snx1 C T 9: 66,097,436 A183T probably benign Het
Srpk2 T C 5: 23,524,517 T375A probably benign Het
Tecpr1 T C 5: 144,197,854 probably null Het
Topaz1 A T 9: 122,748,404 E126D probably benign Het
Ugt2b1 C G 5: 86,917,644 C512S possibly damaging Het
Ugt2b37 C T 5: 87,251,860 W263* probably null Het
Utp20 A T 10: 88,798,746 M750K possibly damaging Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp609 T C 9: 65,700,827 Y1257C probably damaging Het
Other mutations in 1700061G19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:1700061G19Rik APN 17 56882203 nonsense probably null
IGL01833:1700061G19Rik APN 17 56881062 missense probably benign 0.02
IGL02420:1700061G19Rik APN 17 56880494 missense probably damaging 1.00
IGL02969:1700061G19Rik APN 17 56883751 missense probably damaging 1.00
IGL03054:1700061G19Rik UTSW 17 56886528 missense possibly damaging 0.67
R0197:1700061G19Rik UTSW 17 56883835 missense probably benign 0.01
R0257:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0279:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0280:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0281:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0282:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0329:1700061G19Rik UTSW 17 56883631 missense probably benign 0.02
R0330:1700061G19Rik UTSW 17 56883631 missense probably benign 0.02
R0349:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0518:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0519:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0521:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0604:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0883:1700061G19Rik UTSW 17 56883835 missense probably benign 0.01
R1561:1700061G19Rik UTSW 17 56877431 missense probably benign
R1779:1700061G19Rik UTSW 17 56885169 nonsense probably null
R2008:1700061G19Rik UTSW 17 56886478 missense probably benign 0.04
R2102:1700061G19Rik UTSW 17 56884949 nonsense probably null
R2247:1700061G19Rik UTSW 17 56877435 missense possibly damaging 0.83
R2484:1700061G19Rik UTSW 17 56882641 missense probably benign 0.00
R2917:1700061G19Rik UTSW 17 56885141 missense probably damaging 1.00
R3149:1700061G19Rik UTSW 17 56876348 missense probably benign
R3773:1700061G19Rik UTSW 17 56876262 start codon destroyed probably null 0.00
R4829:1700061G19Rik UTSW 17 56883500 splice site probably null
R4860:1700061G19Rik UTSW 17 56888655 missense probably benign 0.09
R4860:1700061G19Rik UTSW 17 56888655 missense probably benign 0.09
R4887:1700061G19Rik UTSW 17 56876324 missense possibly damaging 0.84
R5112:1700061G19Rik UTSW 17 56877465 missense probably benign 0.03
R5161:1700061G19Rik UTSW 17 56882888 missense possibly damaging 0.84
R5214:1700061G19Rik UTSW 17 56886493 missense probably benign
R5287:1700061G19Rik UTSW 17 56876221 unclassified probably benign
R5403:1700061G19Rik UTSW 17 56876221 unclassified probably benign
R5779:1700061G19Rik UTSW 17 56881061 missense probably benign 0.02
R5997:1700061G19Rik UTSW 17 56876373 missense probably benign 0.02
R6198:1700061G19Rik UTSW 17 56882679 missense probably damaging 1.00
R6259:1700061G19Rik UTSW 17 56877513 missense probably benign 0.04
R6357:1700061G19Rik UTSW 17 56877591 critical splice donor site probably null
R6754:1700061G19Rik UTSW 17 56883358 missense probably damaging 0.99
R6842:1700061G19Rik UTSW 17 56877432 missense probably benign 0.00
R7042:1700061G19Rik UTSW 17 56885098 missense possibly damaging 0.73
R7181:1700061G19Rik UTSW 17 56881037 missense probably benign 0.03
R7445:1700061G19Rik UTSW 17 56882973 missense possibly damaging 0.64
R7511:1700061G19Rik UTSW 17 56882954 missense probably damaging 0.98
R8122:1700061G19Rik UTSW 17 56886670 missense possibly damaging 0.50
R8553:1700061G19Rik UTSW 17 56881021 missense probably benign 0.02
R8919:1700061G19Rik UTSW 17 56882218 missense probably benign 0.00
Z1177:1700061G19Rik UTSW 17 56883463 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCCCCACCCTTGATGTG -3'
(R):5'- GCTTTTGTGTATAAAGGTCTGTGTAC -3'

Sequencing Primer
(F):5'- GTGGCTTTTCAGAGACAAATGC -3'
(R):5'- GGAACTCAGACTTAGGTCCTCATG -3'
Posted On2016-06-15