Incidental Mutation 'R5122:Spata31e5'
ID 393322
Institutional Source Beutler Lab
Gene Symbol Spata31e5
Ensembl Gene ENSMUSG00000048411
Gene Name spermatogenesis associated 31 subfamily E member 5
Synonyms Gm597, LOC210962
MMRRC Submission 042710-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R5122 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 28815203-28819333 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28819141 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 47 (S47P)
Ref Sequence ENSEMBL: ENSMUSP00000058140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059937]
AlphaFold E9Q8J5
Predicted Effect probably benign
Transcript: ENSMUST00000059937
AA Change: S47P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: S47P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 112 129 N/A INTRINSIC
Pfam:FAM75 137 472 8.1e-14 PFAM
low complexity region 664 675 N/A INTRINSIC
internal_repeat_1 718 807 1.4e-5 PROSPERO
internal_repeat_1 807 894 1.4e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 78,750,409 (GRCm39) S1727P probably damaging Het
Actr8 A T 14: 29,704,672 (GRCm39) K57N possibly damaging Het
Bcan G T 3: 87,901,514 (GRCm39) S396Y probably damaging Het
Bltp1 A G 3: 37,088,906 (GRCm39) probably null Het
Bmp2k A G 5: 97,234,874 (GRCm39) probably benign Het
Cd274 A G 19: 29,357,965 (GRCm39) H219R possibly damaging Het
Cdc16 A T 8: 13,814,570 (GRCm39) Y118F probably damaging Het
Cdc23 C A 18: 34,784,742 (GRCm39) V7L unknown Het
Chchd3 T C 6: 32,945,240 (GRCm39) R89G probably benign Het
Clstn2 C T 9: 97,343,474 (GRCm39) V658M probably damaging Het
Cpt1b A G 15: 89,308,226 (GRCm39) S160P probably benign Het
Crym T C 7: 119,794,718 (GRCm39) N167S probably benign Het
Dhx16 T A 17: 36,194,202 (GRCm39) Y438N probably damaging Het
Dnah12 A G 14: 26,439,155 (GRCm39) R536G probably benign Het
Dnajc11 A G 4: 152,061,454 (GRCm39) D382G possibly damaging Het
Dync1h1 G A 12: 110,596,114 (GRCm39) G1547D probably damaging Het
Eml3 T A 19: 8,915,060 (GRCm39) probably null Het
Ep400 G A 5: 110,816,036 (GRCm39) P2799S probably damaging Het
Ephb6 T C 6: 41,590,338 (GRCm39) V30A probably benign Het
Fam53b T A 7: 132,380,991 (GRCm39) probably benign Het
Fcrl1 A G 3: 87,293,081 (GRCm39) K246R probably benign Het
Focad G A 4: 88,325,602 (GRCm39) probably null Het
Glipr1l2 T C 10: 111,942,961 (GRCm39) I272T possibly damaging Het
Gm8104 A G 14: 42,966,550 (GRCm39) I101V probably benign Het
Grm5 A G 7: 87,724,028 (GRCm39) I773V probably damaging Het
Hyal1 A T 9: 107,455,268 (GRCm39) T193S probably benign Het
Igkv10-94 C A 6: 68,681,655 (GRCm39) G62* probably null Het
Itsn1 A G 16: 91,690,732 (GRCm39) probably benign Het
Kank4 A G 4: 98,644,804 (GRCm39) S983P probably damaging Het
Krtap16-1 C A 11: 99,876,523 (GRCm39) V294F probably damaging Het
Lama3 T G 18: 12,672,823 (GRCm39) V866G possibly damaging Het
Lrba C T 3: 86,256,461 (GRCm39) R1268* probably null Het
Lrriq1 C T 10: 103,023,314 (GRCm39) V984I probably damaging Het
Macf1 A C 4: 123,346,085 (GRCm39) V4136G probably damaging Het
Mdn1 A T 4: 32,670,593 (GRCm39) E419D probably damaging Het
Nedd4l A G 18: 65,324,518 (GRCm39) Y473C probably damaging Het
Nod2 G T 8: 89,390,748 (GRCm39) D330Y probably damaging Het
Nt5c2 C T 19: 46,878,360 (GRCm39) C458Y probably damaging Het
Numa1 T C 7: 101,662,976 (GRCm39) I681T probably damaging Het
Or10a5 C A 7: 106,636,055 (GRCm39) S231* probably null Het
Papolg C T 11: 23,817,501 (GRCm39) probably null Het
Parn A G 16: 13,472,311 (GRCm39) probably null Het
Pgap2 T C 7: 101,880,598 (GRCm39) F42S probably damaging Het
Phf11d A T 14: 59,590,793 (GRCm39) M188K possibly damaging Het
Pofut2 G C 10: 77,104,399 (GRCm39) R392P probably damaging Het
Prpf18 T C 2: 4,648,520 (GRCm39) D102G probably damaging Het
Rreb1 T A 13: 38,114,744 (GRCm39) I701N probably benign Het
Slc26a5 T C 5: 22,052,194 (GRCm39) K45R probably damaging Het
Slc8a3 A G 12: 81,361,032 (GRCm39) probably null Het
Slf1 T A 13: 77,198,106 (GRCm39) M723L probably benign Het
Sra1 T C 18: 36,800,647 (GRCm39) T187A probably benign Het
Stk17b A C 1: 53,815,717 (GRCm39) N27K probably damaging Het
Tbc1d9 T A 8: 83,963,172 (GRCm39) Y295N probably damaging Het
Tubgcp6 A G 15: 89,000,306 (GRCm39) V353A probably damaging Het
Unc80 A T 1: 66,718,749 (GRCm39) T2991S possibly damaging Het
Urb1 G A 16: 90,548,983 (GRCm39) R2242* probably null Het
Vasp T C 7: 18,998,697 (GRCm39) N20S probably benign Het
Zfp263 A G 16: 3,567,719 (GRCm39) H390R probably damaging Het
Other mutations in Spata31e5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Spata31e5 APN 1 28,817,732 (GRCm39) missense possibly damaging 0.94
IGL00885:Spata31e5 APN 1 28,815,926 (GRCm39) missense unknown
IGL01296:Spata31e5 APN 1 28,816,137 (GRCm39) missense probably benign 0.23
IGL01476:Spata31e5 APN 1 28,816,534 (GRCm39) missense probably benign 0.04
IGL02125:Spata31e5 APN 1 28,815,419 (GRCm39) missense possibly damaging 0.91
IGL02410:Spata31e5 APN 1 28,817,712 (GRCm39) missense probably benign 0.25
IGL02982:Spata31e5 APN 1 28,817,135 (GRCm39) missense probably damaging 1.00
IGL03031:Spata31e5 APN 1 28,817,664 (GRCm39) missense probably benign 0.03
IGL03267:Spata31e5 APN 1 28,816,202 (GRCm39) missense probably damaging 1.00
R0294:Spata31e5 UTSW 1 28,817,744 (GRCm39) missense probably benign 0.00
R0433:Spata31e5 UTSW 1 28,816,423 (GRCm39) nonsense probably null
R0485:Spata31e5 UTSW 1 28,817,223 (GRCm39) missense probably damaging 1.00
R0645:Spata31e5 UTSW 1 28,816,011 (GRCm39) missense probably damaging 0.99
R0744:Spata31e5 UTSW 1 28,816,902 (GRCm39) missense possibly damaging 0.46
R0836:Spata31e5 UTSW 1 28,816,902 (GRCm39) missense possibly damaging 0.46
R1036:Spata31e5 UTSW 1 28,816,883 (GRCm39) missense probably benign 0.01
R1302:Spata31e5 UTSW 1 28,815,421 (GRCm39) missense probably benign 0.00
R1394:Spata31e5 UTSW 1 28,815,890 (GRCm39) missense possibly damaging 0.61
R1395:Spata31e5 UTSW 1 28,815,890 (GRCm39) missense possibly damaging 0.61
R1514:Spata31e5 UTSW 1 28,817,829 (GRCm39) missense possibly damaging 0.83
R1535:Spata31e5 UTSW 1 28,816,505 (GRCm39) missense probably damaging 1.00
R2004:Spata31e5 UTSW 1 28,816,260 (GRCm39) missense probably damaging 1.00
R2021:Spata31e5 UTSW 1 28,817,234 (GRCm39) missense probably damaging 0.98
R2022:Spata31e5 UTSW 1 28,817,234 (GRCm39) missense probably damaging 0.98
R3115:Spata31e5 UTSW 1 28,815,410 (GRCm39) missense possibly damaging 0.92
R3615:Spata31e5 UTSW 1 28,815,656 (GRCm39) missense probably benign 0.26
R3616:Spata31e5 UTSW 1 28,815,656 (GRCm39) missense probably benign 0.26
R3862:Spata31e5 UTSW 1 28,816,722 (GRCm39) missense probably damaging 0.98
R4067:Spata31e5 UTSW 1 28,816,712 (GRCm39) missense probably damaging 0.98
R4119:Spata31e5 UTSW 1 28,817,054 (GRCm39) missense probably damaging 0.99
R4415:Spata31e5 UTSW 1 28,816,214 (GRCm39) missense probably benign 0.01
R5010:Spata31e5 UTSW 1 28,816,943 (GRCm39) missense possibly damaging 0.52
R5109:Spata31e5 UTSW 1 28,816,636 (GRCm39) missense possibly damaging 0.46
R5533:Spata31e5 UTSW 1 28,817,163 (GRCm39) missense probably damaging 1.00
R6085:Spata31e5 UTSW 1 28,817,308 (GRCm39) missense possibly damaging 0.55
R6116:Spata31e5 UTSW 1 28,817,780 (GRCm39) missense probably benign 0.01
R6750:Spata31e5 UTSW 1 28,816,495 (GRCm39) missense probably damaging 0.98
R6757:Spata31e5 UTSW 1 28,819,191 (GRCm39) missense probably damaging 0.98
R6774:Spata31e5 UTSW 1 28,815,974 (GRCm39) missense probably benign 0.00
R7156:Spata31e5 UTSW 1 28,815,848 (GRCm39) missense possibly damaging 0.53
R7365:Spata31e5 UTSW 1 28,819,233 (GRCm39) missense probably benign 0.04
R7739:Spata31e5 UTSW 1 28,816,689 (GRCm39) missense possibly damaging 0.72
R7996:Spata31e5 UTSW 1 28,817,487 (GRCm39) missense probably damaging 0.98
R8082:Spata31e5 UTSW 1 28,816,579 (GRCm39) missense probably benign 0.08
R8281:Spata31e5 UTSW 1 28,817,225 (GRCm39) missense possibly damaging 0.77
R8514:Spata31e5 UTSW 1 28,817,586 (GRCm39) missense probably damaging 1.00
R8944:Spata31e5 UTSW 1 28,816,155 (GRCm39) missense probably benign 0.00
R9042:Spata31e5 UTSW 1 28,816,037 (GRCm39) missense possibly damaging 0.72
R9101:Spata31e5 UTSW 1 28,815,740 (GRCm39) missense probably benign 0.04
R9106:Spata31e5 UTSW 1 28,815,975 (GRCm39) missense probably benign 0.00
R9173:Spata31e5 UTSW 1 28,816,430 (GRCm39) missense probably benign 0.22
R9596:Spata31e5 UTSW 1 28,815,688 (GRCm39) missense probably benign 0.07
R9632:Spata31e5 UTSW 1 28,817,120 (GRCm39) missense probably benign 0.20
R9656:Spata31e5 UTSW 1 28,816,536 (GRCm39) missense probably benign 0.02
R9659:Spata31e5 UTSW 1 28,816,536 (GRCm39) missense probably benign 0.02
R9661:Spata31e5 UTSW 1 28,816,536 (GRCm39) missense probably benign 0.02
R9663:Spata31e5 UTSW 1 28,816,536 (GRCm39) missense probably benign 0.02
R9710:Spata31e5 UTSW 1 28,817,120 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TTCCTGCAGACTGATGTGTG -3'
(R):5'- TGCCTATGATTCAGAAGATGGAGAA -3'

Sequencing Primer
(F):5'- AACATGCCCCTGAGAGAGCTTG -3'
(R):5'- TGGACATGACCTTTGCCA -3'
Posted On 2016-06-15