Incidental Mutation 'R5122:Fcrl1'
ID393329
Institutional Source Beutler Lab
Gene Symbol Fcrl1
Ensembl Gene ENSMUSG00000059994
Gene NameFc receptor-like 1
SynonymsFcrh1, BXMAS1-like, IFGP1, moFcRH1L, moFcRH1S, A230020G22Rik, mBXMH1, moFcRH1, mIFGP1
MMRRC Submission 042710-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5122 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location87376387-87402934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87385774 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 246 (K246R)
Ref Sequence ENSEMBL: ENSMUSP00000072300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072480] [ENSMUST00000163661] [ENSMUST00000167200] [ENSMUST00000191666] [ENSMUST00000194786]
Predicted Effect probably benign
Transcript: ENSMUST00000072480
AA Change: K246R

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000072300
Gene: ENSMUSG00000059994
AA Change: K246R

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 28 113 4.03e-8 SMART
IG 123 204 1.35e0 SMART
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163661
AA Change: K266R

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130936
Gene: ENSMUSG00000059994
AA Change: K266R

DomainStartEndE-ValueType
IG 48 133 4.03e-8 SMART
IG 143 224 1.35e0 SMART
transmembrane domain 241 263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167200
SMART Domains Protein: ENSMUSP00000128235
Gene: ENSMUSG00000059994

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 28 113 4.03e-8 SMART
IG 123 204 1.35e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191666
SMART Domains Protein: ENSMUSP00000141916
Gene: ENSMUSG00000059994

DomainStartEndE-ValueType
IG_like 9 94 4.5e-2 SMART
IG 28 113 1.7e-10 SMART
IG 123 204 5.5e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193854
Predicted Effect probably benign
Transcript: ENSMUST00000194786
AA Change: K246R

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142286
Gene: ENSMUSG00000059994
AA Change: K246R

DomainStartEndE-ValueType
IG_like 9 94 4.5e-2 SMART
IG 28 113 1.7e-10 SMART
IG 123 204 5.5e-3 SMART
transmembrane domain 221 243 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin receptor superfamily and is one of several Fc receptor-like glycoproteins clustered on the long arm of chromosome 1. The encoded protein contains three extracellular C2-like immunoglobulin domains, a transmembrane domain and a cytoplasmic domain with two immunoreceptor-tyrosine activation motifs. This protein may play a role in the regulation of cancer cell growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,034,757 probably null Het
Acan T C 7: 79,100,661 S1727P probably damaging Het
Actr8 A T 14: 29,982,715 K57N possibly damaging Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Bmp2k A G 5: 97,087,015 probably benign Het
Cd274 A G 19: 29,380,565 H219R possibly damaging Het
Cdc16 A T 8: 13,764,570 Y118F probably damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Chchd3 T C 6: 32,968,305 R89G probably benign Het
Clstn2 C T 9: 97,461,421 V658M probably damaging Het
Cpt1b A G 15: 89,424,023 S160P probably benign Het
Crym T C 7: 120,195,495 N167S probably benign Het
Dhx16 T A 17: 35,883,310 Y438N probably damaging Het
Dnah12 A G 14: 26,718,000 R536G probably benign Het
Dnajc11 A G 4: 151,976,997 D382G possibly damaging Het
Dync1h1 G A 12: 110,629,680 G1547D probably damaging Het
Eml3 T A 19: 8,937,696 probably null Het
Ep400 G A 5: 110,668,170 P2799S probably damaging Het
Ephb6 T C 6: 41,613,404 V30A probably benign Het
Fam53b T A 7: 132,779,262 probably benign Het
Focad G A 4: 88,407,365 probably null Het
Glipr1l2 T C 10: 112,107,056 I272T possibly damaging Het
Gm597 A G 1: 28,780,060 S47P probably benign Het
Gm8104 A G 14: 43,109,093 I101V probably benign Het
Grm5 A G 7: 88,074,820 I773V probably damaging Het
Hyal1 A T 9: 107,578,069 T193S probably benign Het
Igkv10-94 C A 6: 68,704,671 G62* probably null Het
Itsn1 A G 16: 91,893,844 probably benign Het
Kank4 A G 4: 98,756,567 S983P probably damaging Het
Krtap16-1 C A 11: 99,985,697 V294F probably damaging Het
Lama3 T G 18: 12,539,766 V866G possibly damaging Het
Lrba C T 3: 86,349,154 R1268* probably null Het
Lrriq1 C T 10: 103,187,453 V984I probably damaging Het
Macf1 A C 4: 123,452,292 V4136G probably damaging Het
Mdn1 A T 4: 32,670,593 E419D probably damaging Het
Nedd4l A G 18: 65,191,447 Y473C probably damaging Het
Nod2 G T 8: 88,664,120 D330Y probably damaging Het
Nt5c2 C T 19: 46,889,921 C458Y probably damaging Het
Numa1 T C 7: 102,013,769 I681T probably damaging Het
Olfr713 C A 7: 107,036,848 S231* probably null Het
Papolg C T 11: 23,867,501 probably null Het
Parn A G 16: 13,654,447 probably null Het
Pgap2 T C 7: 102,231,391 F42S probably damaging Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Pofut2 G C 10: 77,268,565 R392P probably damaging Het
Prpf18 T C 2: 4,643,709 D102G probably damaging Het
Rreb1 T A 13: 37,930,768 I701N probably benign Het
Slc26a5 T C 5: 21,847,196 K45R probably damaging Het
Slc8a3 A G 12: 81,314,258 probably null Het
Slf1 T A 13: 77,049,987 M723L probably benign Het
Sra1 T C 18: 36,667,594 T187A probably benign Het
Stk17b A C 1: 53,776,558 N27K probably damaging Het
Tbc1d9 T A 8: 83,236,543 Y295N probably damaging Het
Tubgcp6 A G 15: 89,116,103 V353A probably damaging Het
Unc80 A T 1: 66,679,590 T2991S possibly damaging Het
Urb1 G A 16: 90,752,095 R2242* probably null Het
Vasp T C 7: 19,264,772 N20S probably benign Het
Zfp263 A G 16: 3,749,855 H390R probably damaging Het
Other mutations in Fcrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Fcrl1 APN 3 87389635 missense probably damaging 0.99
IGL01884:Fcrl1 APN 3 87384737 missense probably damaging 1.00
IGL02029:Fcrl1 APN 3 87376487 utr 5 prime probably benign
IGL02231:Fcrl1 APN 3 87385162 missense possibly damaging 0.94
IGL02231:Fcrl1 APN 3 87385163 missense probably damaging 1.00
IGL02405:Fcrl1 APN 3 87385767 missense probably damaging 0.99
IGL02858:Fcrl1 APN 3 87384705 missense probably damaging 1.00
IGL03133:Fcrl1 APN 3 87389392 missense probably benign 0.00
IGL03176:Fcrl1 APN 3 87391257 missense probably damaging 1.00
IGL03352:Fcrl1 APN 3 87385091 missense probably benign 0.01
R1497:Fcrl1 UTSW 3 87384802 missense probably damaging 1.00
R1569:Fcrl1 UTSW 3 87384705 missense probably damaging 1.00
R1581:Fcrl1 UTSW 3 87385723 missense possibly damaging 0.94
R1778:Fcrl1 UTSW 3 87385319 splice site probably benign
R1959:Fcrl1 UTSW 3 87376520 missense possibly damaging 0.92
R2928:Fcrl1 UTSW 3 87391257 missense probably benign 0.19
R4677:Fcrl1 UTSW 3 87390256 missense possibly damaging 0.61
R5507:Fcrl1 UTSW 3 87391242 missense probably benign 0.16
R6363:Fcrl1 UTSW 3 87385168 missense probably damaging 0.96
R6478:Fcrl1 UTSW 3 87389639 missense probably benign 0.41
R6559:Fcrl1 UTSW 3 87391253 missense probably benign 0.33
R6985:Fcrl1 UTSW 3 87389650 missense probably benign
R7291:Fcrl1 UTSW 3 87385781 critical splice donor site probably null
Z1177:Fcrl1 UTSW 3 87389363 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACACCGGAGATGTCTGTTC -3'
(R):5'- TGATGTCAGAACCAGAGCTG -3'

Sequencing Primer
(F):5'- GAGATGTCTGTTCTCCAAACCCAATC -3'
(R):5'- TGAGCAGCCGAGTGTTCCTC -3'
Posted On2016-06-15