Incidental Mutation 'R5122:Bcan'
ID393330
Institutional Source Beutler Lab
Gene Symbol Bcan
Ensembl Gene ENSMUSG00000004892
Gene Namebrevican
SynonymsCspg7
MMRRC Submission 042710-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5122 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location87987531-88000230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87994207 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 396 (S396Y)
Ref Sequence ENSEMBL: ENSMUSP00000088491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090971] [ENSMUST00000194193]
Predicted Effect probably damaging
Transcript: ENSMUST00000090971
AA Change: S396Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088491
Gene: ENSMUSG00000004892
AA Change: S396Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGv 51 138 5.74e-13 SMART
LINK 154 251 9.37e-55 SMART
LINK 255 353 2.67e-59 SMART
low complexity region 355 369 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 505 519 N/A INTRINSIC
EGF 625 658 1.07e-5 SMART
CLECT 664 785 1.15e-33 SMART
CCP 791 847 2.7e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193276
Predicted Effect probably benign
Transcript: ENSMUST00000194193
SMART Domains Protein: ENSMUSP00000141455
Gene: ENSMUSG00000004892

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:IGv 51 105 1e-33 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194596
Meta Mutation Damage Score 0.0702 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lectican family of chondroitin sulfate proteoglycans that is specifically expressed in the central nervous system. This protein is developmentally regulated and may function in the formation of the brain extracellular matrix. This protein is highly expressed in gliomas and may promote the growth and cell motility of brain tumor cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutation of this gene results in impaired LTP maintenance, but mutant animals show normal behavior and spatial learning capabilities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,034,757 probably null Het
Acan T C 7: 79,100,661 S1727P probably damaging Het
Actr8 A T 14: 29,982,715 K57N possibly damaging Het
Bmp2k A G 5: 97,087,015 probably benign Het
Cd274 A G 19: 29,380,565 H219R possibly damaging Het
Cdc16 A T 8: 13,764,570 Y118F probably damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Chchd3 T C 6: 32,968,305 R89G probably benign Het
Clstn2 C T 9: 97,461,421 V658M probably damaging Het
Cpt1b A G 15: 89,424,023 S160P probably benign Het
Crym T C 7: 120,195,495 N167S probably benign Het
Dhx16 T A 17: 35,883,310 Y438N probably damaging Het
Dnah12 A G 14: 26,718,000 R536G probably benign Het
Dnajc11 A G 4: 151,976,997 D382G possibly damaging Het
Dync1h1 G A 12: 110,629,680 G1547D probably damaging Het
Eml3 T A 19: 8,937,696 probably null Het
Ep400 G A 5: 110,668,170 P2799S probably damaging Het
Ephb6 T C 6: 41,613,404 V30A probably benign Het
Fam53b T A 7: 132,779,262 probably benign Het
Fcrl1 A G 3: 87,385,774 K246R probably benign Het
Focad G A 4: 88,407,365 probably null Het
Glipr1l2 T C 10: 112,107,056 I272T possibly damaging Het
Gm597 A G 1: 28,780,060 S47P probably benign Het
Gm8104 A G 14: 43,109,093 I101V probably benign Het
Grm5 A G 7: 88,074,820 I773V probably damaging Het
Hyal1 A T 9: 107,578,069 T193S probably benign Het
Igkv10-94 C A 6: 68,704,671 G62* probably null Het
Itsn1 A G 16: 91,893,844 probably benign Het
Kank4 A G 4: 98,756,567 S983P probably damaging Het
Krtap16-1 C A 11: 99,985,697 V294F probably damaging Het
Lama3 T G 18: 12,539,766 V866G possibly damaging Het
Lrba C T 3: 86,349,154 R1268* probably null Het
Lrriq1 C T 10: 103,187,453 V984I probably damaging Het
Macf1 A C 4: 123,452,292 V4136G probably damaging Het
Mdn1 A T 4: 32,670,593 E419D probably damaging Het
Nedd4l A G 18: 65,191,447 Y473C probably damaging Het
Nod2 G T 8: 88,664,120 D330Y probably damaging Het
Nt5c2 C T 19: 46,889,921 C458Y probably damaging Het
Numa1 T C 7: 102,013,769 I681T probably damaging Het
Olfr713 C A 7: 107,036,848 S231* probably null Het
Papolg C T 11: 23,867,501 probably null Het
Parn A G 16: 13,654,447 probably null Het
Pgap2 T C 7: 102,231,391 F42S probably damaging Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Pofut2 G C 10: 77,268,565 R392P probably damaging Het
Prpf18 T C 2: 4,643,709 D102G probably damaging Het
Rreb1 T A 13: 37,930,768 I701N probably benign Het
Slc26a5 T C 5: 21,847,196 K45R probably damaging Het
Slc8a3 A G 12: 81,314,258 probably null Het
Slf1 T A 13: 77,049,987 M723L probably benign Het
Sra1 T C 18: 36,667,594 T187A probably benign Het
Stk17b A C 1: 53,776,558 N27K probably damaging Het
Tbc1d9 T A 8: 83,236,543 Y295N probably damaging Het
Tubgcp6 A G 15: 89,116,103 V353A probably damaging Het
Unc80 A T 1: 66,679,590 T2991S possibly damaging Het
Urb1 G A 16: 90,752,095 R2242* probably null Het
Vasp T C 7: 19,264,772 N20S probably benign Het
Zfp263 A G 16: 3,749,855 H390R probably damaging Het
Other mutations in Bcan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Bcan APN 3 87994174 missense probably damaging 1.00
IGL00981:Bcan APN 3 87997832 missense possibly damaging 0.66
IGL02355:Bcan APN 3 87994142 missense possibly damaging 0.65
IGL02362:Bcan APN 3 87994142 missense possibly damaging 0.65
IGL03190:Bcan APN 3 87993050 unclassified probably benign
R0392:Bcan UTSW 3 87993562 nonsense probably null
R0938:Bcan UTSW 3 87993154 missense possibly damaging 0.96
R1118:Bcan UTSW 3 87989227 missense probably damaging 1.00
R1559:Bcan UTSW 3 87994212 missense probably damaging 0.96
R1653:Bcan UTSW 3 87994196 missense probably damaging 0.99
R1699:Bcan UTSW 3 87989236 missense probably damaging 1.00
R1762:Bcan UTSW 3 87993625 missense probably benign 0.00
R1802:Bcan UTSW 3 87993108 missense possibly damaging 0.58
R1870:Bcan UTSW 3 87995601 missense probably damaging 1.00
R1929:Bcan UTSW 3 87993094 missense probably damaging 1.00
R2172:Bcan UTSW 3 87996581 missense probably damaging 1.00
R2271:Bcan UTSW 3 87993094 missense probably damaging 1.00
R4036:Bcan UTSW 3 87996116 critical splice donor site probably null
R4363:Bcan UTSW 3 87997098 missense probably damaging 1.00
R4491:Bcan UTSW 3 87990233 nonsense probably null
R5111:Bcan UTSW 3 87994207 missense probably damaging 1.00
R5167:Bcan UTSW 3 87994207 missense probably damaging 1.00
R5234:Bcan UTSW 3 87996146 missense probably damaging 1.00
R5363:Bcan UTSW 3 87995487 missense probably damaging 1.00
R5365:Bcan UTSW 3 87989235 missense probably damaging 1.00
R5544:Bcan UTSW 3 87993053 critical splice donor site probably null
R5663:Bcan UTSW 3 87995613 missense probably damaging 0.98
R6044:Bcan UTSW 3 87995643 missense probably damaging 1.00
R6495:Bcan UTSW 3 87996597 missense possibly damaging 0.91
R6725:Bcan UTSW 3 87995484 missense possibly damaging 0.69
R6764:Bcan UTSW 3 87988378 missense probably damaging 1.00
R7000:Bcan UTSW 3 87988379 nonsense probably null
R7294:Bcan UTSW 3 87995524 missense possibly damaging 0.51
R7338:Bcan UTSW 3 87994243 missense probably damaging 1.00
R7942:Bcan UTSW 3 87993075 missense probably benign 0.40
R8428:Bcan UTSW 3 87997098 missense probably damaging 1.00
X0013:Bcan UTSW 3 87996159 missense possibly damaging 0.69
Z1176:Bcan UTSW 3 87990750 missense probably damaging 1.00
Z1176:Bcan UTSW 3 87990755 missense probably damaging 1.00
Z1176:Bcan UTSW 3 87995650 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTAGTGACCACTTGGGCTTG -3'
(R):5'- GATGGGTGAAGCACATTCCAG -3'

Sequencing Primer
(F):5'- ACCACTTGGGCTTGCCCTC -3'
(R):5'- CACCCTGGGAGGATTCAAATGC -3'
Posted On2016-06-15