Incidental Mutation 'R5122:Dnajc11'
ID393335
Institutional Source Beutler Lab
Gene Symbol Dnajc11
Ensembl Gene ENSMUSG00000039768
Gene NameDnaJ heat shock protein family (Hsp40) member C11
Synonyms
MMRRC Submission 042710-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R5122 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location151933691-151982137 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 151976997 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 382 (D382G)
Ref Sequence ENSEMBL: ENSMUSP00000051643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062904] [ENSMUST00000139069]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062904
AA Change: D382G

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000051643
Gene: ENSMUSG00000039768
AA Change: D382G

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
Pfam:DUF3395 410 549 2e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128582
Predicted Effect probably benign
Transcript: ENSMUST00000139069
SMART Domains Protein: ENSMUSP00000119604
Gene: ENSMUSG00000039768

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
coiled coil region 318 349 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149337
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit motor neuron pathology, disorganized cristae and lymphoid abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,034,757 probably null Het
Acan T C 7: 79,100,661 S1727P probably damaging Het
Actr8 A T 14: 29,982,715 K57N possibly damaging Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Bmp2k A G 5: 97,087,015 probably benign Het
Cd274 A G 19: 29,380,565 H219R possibly damaging Het
Cdc16 A T 8: 13,764,570 Y118F probably damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Chchd3 T C 6: 32,968,305 R89G probably benign Het
Clstn2 C T 9: 97,461,421 V658M probably damaging Het
Cpt1b A G 15: 89,424,023 S160P probably benign Het
Crym T C 7: 120,195,495 N167S probably benign Het
Dhx16 T A 17: 35,883,310 Y438N probably damaging Het
Dnah12 A G 14: 26,718,000 R536G probably benign Het
Dync1h1 G A 12: 110,629,680 G1547D probably damaging Het
Eml3 T A 19: 8,937,696 probably null Het
Ep400 G A 5: 110,668,170 P2799S probably damaging Het
Ephb6 T C 6: 41,613,404 V30A probably benign Het
Fam53b T A 7: 132,779,262 probably benign Het
Fcrl1 A G 3: 87,385,774 K246R probably benign Het
Focad G A 4: 88,407,365 probably null Het
Glipr1l2 T C 10: 112,107,056 I272T possibly damaging Het
Gm597 A G 1: 28,780,060 S47P probably benign Het
Gm8104 A G 14: 43,109,093 I101V probably benign Het
Grm5 A G 7: 88,074,820 I773V probably damaging Het
Hyal1 A T 9: 107,578,069 T193S probably benign Het
Igkv10-94 C A 6: 68,704,671 G62* probably null Het
Itsn1 A G 16: 91,893,844 probably benign Het
Kank4 A G 4: 98,756,567 S983P probably damaging Het
Krtap16-1 C A 11: 99,985,697 V294F probably damaging Het
Lama3 T G 18: 12,539,766 V866G possibly damaging Het
Lrba C T 3: 86,349,154 R1268* probably null Het
Lrriq1 C T 10: 103,187,453 V984I probably damaging Het
Macf1 A C 4: 123,452,292 V4136G probably damaging Het
Mdn1 A T 4: 32,670,593 E419D probably damaging Het
Nedd4l A G 18: 65,191,447 Y473C probably damaging Het
Nod2 G T 8: 88,664,120 D330Y probably damaging Het
Nt5c2 C T 19: 46,889,921 C458Y probably damaging Het
Numa1 T C 7: 102,013,769 I681T probably damaging Het
Olfr713 C A 7: 107,036,848 S231* probably null Het
Papolg C T 11: 23,867,501 probably null Het
Parn A G 16: 13,654,447 probably null Het
Pgap2 T C 7: 102,231,391 F42S probably damaging Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Pofut2 G C 10: 77,268,565 R392P probably damaging Het
Prpf18 T C 2: 4,643,709 D102G probably damaging Het
Rreb1 T A 13: 37,930,768 I701N probably benign Het
Slc26a5 T C 5: 21,847,196 K45R probably damaging Het
Slc8a3 A G 12: 81,314,258 probably null Het
Slf1 T A 13: 77,049,987 M723L probably benign Het
Sra1 T C 18: 36,667,594 T187A probably benign Het
Stk17b A C 1: 53,776,558 N27K probably damaging Het
Tbc1d9 T A 8: 83,236,543 Y295N probably damaging Het
Tubgcp6 A G 15: 89,116,103 V353A probably damaging Het
Unc80 A T 1: 66,679,590 T2991S possibly damaging Het
Urb1 G A 16: 90,752,095 R2242* probably null Het
Vasp T C 7: 19,264,772 N20S probably benign Het
Zfp263 A G 16: 3,749,855 H390R probably damaging Het
Other mutations in Dnajc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Dnajc11 APN 4 151979302 missense probably damaging 0.99
IGL02253:Dnajc11 APN 4 151950519 nonsense probably null
IGL02606:Dnajc11 APN 4 151979484 missense probably benign 0.18
IGL02969:Dnajc11 APN 4 151978046 missense probably benign 0.33
IGL03062:Dnajc11 APN 4 151970861 missense possibly damaging 0.92
PIT4812001:Dnajc11 UTSW 4 151952889 missense probably benign 0.04
R0601:Dnajc11 UTSW 4 151969936 missense probably damaging 1.00
R0620:Dnajc11 UTSW 4 151973628 missense possibly damaging 0.54
R0639:Dnajc11 UTSW 4 151969936 missense probably damaging 1.00
R1694:Dnajc11 UTSW 4 151979273 missense probably damaging 1.00
R4091:Dnajc11 UTSW 4 151978093 unclassified probably benign
R4545:Dnajc11 UTSW 4 151979941 missense probably damaging 1.00
R4548:Dnajc11 UTSW 4 151973617 missense possibly damaging 0.93
R4720:Dnajc11 UTSW 4 151968539 missense probably damaging 1.00
R4732:Dnajc11 UTSW 4 151970967 unclassified probably benign
R4751:Dnajc11 UTSW 4 151968542 missense probably benign 0.01
R4895:Dnajc11 UTSW 4 151979933 missense probably damaging 1.00
R5127:Dnajc11 UTSW 4 151969814 unclassified probably benign
R5174:Dnajc11 UTSW 4 151979984 missense probably damaging 1.00
R5180:Dnajc11 UTSW 4 151969939 missense probably damaging 1.00
R5319:Dnajc11 UTSW 4 151968526 missense probably damaging 1.00
R5624:Dnajc11 UTSW 4 151979510 missense probably benign
R6056:Dnajc11 UTSW 4 151978126 unclassified probably benign
R6434:Dnajc11 UTSW 4 151979294 missense probably damaging 1.00
R7635:Dnajc11 UTSW 4 151968611 missense probably damaging 1.00
R7652:Dnajc11 UTSW 4 151974225 missense probably damaging 0.99
R7937:Dnajc11 UTSW 4 151950452 missense probably damaging 1.00
R7940:Dnajc11 UTSW 4 151968588 missense probably benign 0.00
R8093:Dnajc11 UTSW 4 151969900 missense probably damaging 1.00
R8361:Dnajc11 UTSW 4 151970911 missense probably damaging 0.99
Z1176:Dnajc11 UTSW 4 151933783 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTTGGACTCCAGTTCAGTATC -3'
(R):5'- GCACCATGCTAAGCACTCTG -3'

Sequencing Primer
(F):5'- TGGACTCCAGTTCAGTATCACACG -3'
(R):5'- CATGCTAAGCACTCTGTGGGTAAC -3'
Posted On2016-06-15