Mutagenetix > Incidental Mutation

Incidental Mutation 'R5122:Ep400'

393338

Institutional Source

Beutler Lab

Gene Symbol

Ep400

Ensembl Gene

ENSMUSG00000029505

Gene Name

E1A binding protein p400

Synonyms

mDomino, 1700020J09Rik, p400

MMRRC Submission

042710-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5122 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110664373-110770717 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 110668170 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 2799 (P2799S)

Ref Sequence

ENSEMBL: ENSMUSP00000108055 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112435] [ENSMUST00000112436]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000041558
AA Change: P2835S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: P2835S

Domain	Start	End	E-Value	Type
Pfam:EP400_N	1	461	1.6e-232	PFAM
low complexity region	519	532	N/A	INTRINSIC
low complexity region	550	561	N/A	INTRINSIC
low complexity region	598	620	N/A	INTRINSIC
low complexity region	631	645	N/A	INTRINSIC
low complexity region	658	686	N/A	INTRINSIC
HSA	762	833	1.31e-31	SMART
low complexity region	908	925	N/A	INTRINSIC
DEXDc	1049	1238	2.76e-15	SMART
Blast:DEXDc	1276	1317	2e-15	BLAST
low complexity region	1407	1417	N/A	INTRINSIC
HELICc	1807	1893	1.17e-4	SMART
low complexity region	2006	2019	N/A	INTRINSIC
low complexity region	2080	2100	N/A	INTRINSIC
low complexity region	2214	2223	N/A	INTRINSIC
SANT	2243	2310	3.57e-1	SMART
low complexity region	2402	2489	N/A	INTRINSIC
low complexity region	2596	2608	N/A	INTRINSIC
low complexity region	2644	2679	N/A	INTRINSIC
low complexity region	2694	2738	N/A	INTRINSIC
low complexity region	2769	2806	N/A	INTRINSIC
low complexity region	2846	2883	N/A	INTRINSIC
low complexity region	2933	2947	N/A	INTRINSIC
low complexity region	2974	2986	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112435
AA Change: P2709S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505
AA Change: P2709S

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
low complexity region	121	145	N/A	INTRINSIC
low complexity region	262	287	N/A	INTRINSIC
low complexity region	298	308	N/A	INTRINSIC
low complexity region	313	329	N/A	INTRINSIC
coiled coil region	418	447	N/A	INTRINSIC
low complexity region	471	485	N/A	INTRINSIC
low complexity region	556	569	N/A	INTRINSIC
low complexity region	587	598	N/A	INTRINSIC
low complexity region	635	657	N/A	INTRINSIC
low complexity region	668	682	N/A	INTRINSIC
low complexity region	695	723	N/A	INTRINSIC
HSA	799	870	1.31e-31	SMART
low complexity region	945	962	N/A	INTRINSIC
DEXDc	1086	1275	2.76e-15	SMART
Blast:DEXDc	1313	1354	2e-15	BLAST
low complexity region	1444	1454	N/A	INTRINSIC
internal_repeat_1	1556	1646	6.82e-5	PROSPERO
low complexity region	1887	1900	N/A	INTRINSIC
low complexity region	1961	1981	N/A	INTRINSIC
low complexity region	2095	2104	N/A	INTRINSIC
SANT	2124	2191	3.57e-1	SMART
low complexity region	2283	2370	N/A	INTRINSIC
internal_repeat_1	2371	2463	6.82e-5	PROSPERO
low complexity region	2477	2489	N/A	INTRINSIC
low complexity region	2525	2560	N/A	INTRINSIC
low complexity region	2575	2619	N/A	INTRINSIC
low complexity region	2645	2659	N/A	INTRINSIC
low complexity region	2660	2680	N/A	INTRINSIC
low complexity region	2720	2757	N/A	INTRINSIC
low complexity region	2807	2821	N/A	INTRINSIC
low complexity region	2848	2860	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112436
AA Change: P2799S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: P2799S

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
low complexity region	121	145	N/A	INTRINSIC
low complexity region	262	287	N/A	INTRINSIC
low complexity region	298	308	N/A	INTRINSIC
low complexity region	313	329	N/A	INTRINSIC
coiled coil region	418	449	N/A	INTRINSIC
low complexity region	472	482	N/A	INTRINSIC
low complexity region	483	496	N/A	INTRINSIC
low complexity region	514	525	N/A	INTRINSIC
low complexity region	562	584	N/A	INTRINSIC
low complexity region	595	609	N/A	INTRINSIC
low complexity region	622	650	N/A	INTRINSIC
HSA	726	797	1.31e-31	SMART
low complexity region	872	889	N/A	INTRINSIC
DEXDc	1013	1202	2.76e-15	SMART
Blast:DEXDc	1240	1281	2e-15	BLAST
low complexity region	1371	1381	N/A	INTRINSIC
internal_repeat_1	1483	1573	6.76e-5	PROSPERO
HELICc	1771	1857	1.17e-4	SMART
low complexity region	1970	1983	N/A	INTRINSIC
low complexity region	2044	2064	N/A	INTRINSIC
low complexity region	2178	2187	N/A	INTRINSIC
SANT	2207	2274	3.57e-1	SMART
low complexity region	2366	2453	N/A	INTRINSIC
internal_repeat_1	2454	2546	6.76e-5	PROSPERO
low complexity region	2560	2572	N/A	INTRINSIC
low complexity region	2608	2643	N/A	INTRINSIC
low complexity region	2658	2702	N/A	INTRINSIC
low complexity region	2733	2770	N/A	INTRINSIC
low complexity region	2810	2847	N/A	INTRINSIC
low complexity region	2897	2911	N/A	INTRINSIC
low complexity region	2938	2950	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122901

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144581

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184384

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 37,034,757		probably null	Het
Acan	T	C	7: 79,100,661	S1727P	probably damaging	Het
Actr8	A	T	14: 29,982,715	K57N	possibly damaging	Het
Bcan	G	T	3: 87,994,207	S396Y	probably damaging	Het
Bmp2k	A	G	5: 97,087,015		probably benign	Het
Cd274	A	G	19: 29,380,565	H219R	possibly damaging	Het
Cdc16	A	T	8: 13,764,570	Y118F	probably damaging	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Chchd3	T	C	6: 32,968,305	R89G	probably benign	Het
Clstn2	C	T	9: 97,461,421	V658M	probably damaging	Het
Cpt1b	A	G	15: 89,424,023	S160P	probably benign	Het
Crym	T	C	7: 120,195,495	N167S	probably benign	Het
Dhx16	T	A	17: 35,883,310	Y438N	probably damaging	Het
Dnah12	A	G	14: 26,718,000	R536G	probably benign	Het
Dnajc11	A	G	4: 151,976,997	D382G	possibly damaging	Het
Dync1h1	G	A	12: 110,629,680	G1547D	probably damaging	Het
Eml3	T	A	19: 8,937,696		probably null	Het
Ephb6	T	C	6: 41,613,404	V30A	probably benign	Het
Fam53b	T	A	7: 132,779,262		probably benign	Het
Fcrl1	A	G	3: 87,385,774	K246R	probably benign	Het
Focad	G	A	4: 88,407,365		probably null	Het
Glipr1l2	T	C	10: 112,107,056	I272T	possibly damaging	Het
Gm597	A	G	1: 28,780,060	S47P	probably benign	Het
Gm8104	A	G	14: 43,109,093	I101V	probably benign	Het
Grm5	A	G	7: 88,074,820	I773V	probably damaging	Het
Hyal1	A	T	9: 107,578,069	T193S	probably benign	Het
Igkv10-94	C	A	6: 68,704,671	G62*	probably null	Het
Itsn1	A	G	16: 91,893,844		probably benign	Het
Kank4	A	G	4: 98,756,567	S983P	probably damaging	Het
Krtap16-1	C	A	11: 99,985,697	V294F	probably damaging	Het
Lama3	T	G	18: 12,539,766	V866G	possibly damaging	Het
Lrba	C	T	3: 86,349,154	R1268*	probably null	Het
Lrriq1	C	T	10: 103,187,453	V984I	probably damaging	Het
Macf1	A	C	4: 123,452,292	V4136G	probably damaging	Het
Mdn1	A	T	4: 32,670,593	E419D	probably damaging	Het
Nedd4l	A	G	18: 65,191,447	Y473C	probably damaging	Het
Nod2	G	T	8: 88,664,120	D330Y	probably damaging	Het
Nt5c2	C	T	19: 46,889,921	C458Y	probably damaging	Het
Numa1	T	C	7: 102,013,769	I681T	probably damaging	Het
Olfr713	C	A	7: 107,036,848	S231*	probably null	Het
Papolg	C	T	11: 23,867,501		probably null	Het
Parn	A	G	16: 13,654,447		probably null	Het
Pgap2	T	C	7: 102,231,391	F42S	probably damaging	Het
Phf11d	A	T	14: 59,353,344	M188K	possibly damaging	Het
Pofut2	G	C	10: 77,268,565	R392P	probably damaging	Het
Prpf18	T	C	2: 4,643,709	D102G	probably damaging	Het
Rreb1	T	A	13: 37,930,768	I701N	probably benign	Het
Slc26a5	T	C	5: 21,847,196	K45R	probably damaging	Het
Slc8a3	A	G	12: 81,314,258		probably null	Het
Slf1	T	A	13: 77,049,987	M723L	probably benign	Het
Sra1	T	C	18: 36,667,594	T187A	probably benign	Het
Stk17b	A	C	1: 53,776,558	N27K	probably damaging	Het
Tbc1d9	T	A	8: 83,236,543	Y295N	probably damaging	Het
Tubgcp6	A	G	15: 89,116,103	V353A	probably damaging	Het
Unc80	A	T	1: 66,679,590	T2991S	possibly damaging	Het
Urb1	G	A	16: 90,752,095	R2242*	probably null	Het
Vasp	T	C	7: 19,264,772	N20S	probably benign	Het
Zfp263	A	G	16: 3,749,855	H390R	probably damaging	Het

Other mutations in Ep400

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Ep400	APN	5	110687841	missense	unknown
IGL00585:Ep400	APN	5	110755905	missense	possibly damaging	0.70
IGL00586:Ep400	APN	5	110739594	missense	probably damaging	1.00
IGL00816:Ep400	APN	5	110735490	unclassified	probably benign
IGL01066:Ep400	APN	5	110668199	splice site	probably benign
IGL01302:Ep400	APN	5	110742048	missense	probably benign	0.00
IGL01568:Ep400	APN	5	110719495	missense	unknown
IGL01833:Ep400	APN	5	110680008	missense	unknown
IGL02086:Ep400	APN	5	110676943	splice site	probably benign
IGL02266:Ep400	APN	5	110695297	unclassified	probably benign
IGL02288:Ep400	APN	5	110683836	splice site	probably benign
IGL02301:Ep400	APN	5	110674960	missense	probably damaging	1.00
IGL02377:Ep400	APN	5	110720825	missense	unknown
IGL02382:Ep400	APN	5	110701728	missense	unknown
IGL02419:Ep400	APN	5	110697376	splice site	probably null
IGL02591:Ep400	APN	5	110733772	unclassified	probably benign
IGL02981:Ep400	APN	5	110756103	missense	possibly damaging	0.79
IGL02981:Ep400	APN	5	110691610	splice site	probably benign
IGL03173:Ep400	APN	5	110708871	unclassified	probably benign
IGL03244:Ep400	APN	5	110727563	missense	unknown
IGL03333:Ep400	APN	5	110703566	missense	unknown
santol	UTSW	5	110701671	missense	unknown
PIT4243001:Ep400	UTSW	5	110735580	missense	unknown
PIT4260001:Ep400	UTSW	5	110693171	nonsense	probably null
R0017:Ep400	UTSW	5	110673529	missense	probably damaging	1.00
R0179:Ep400	UTSW	5	110668649	missense	probably damaging	0.99
R0243:Ep400	UTSW	5	110724407	splice site	probably benign
R0366:Ep400	UTSW	5	110701671	missense	unknown
R0508:Ep400	UTSW	5	110739508	missense	probably benign	0.00
R0541:Ep400	UTSW	5	110705016	missense	unknown
R0558:Ep400	UTSW	5	110685067	splice site	probably benign
R0576:Ep400	UTSW	5	110711093	unclassified	probably benign
R0595:Ep400	UTSW	5	110703542	missense	unknown
R0671:Ep400	UTSW	5	110688196	missense	unknown
R0763:Ep400	UTSW	5	110665837	missense	probably damaging	1.00
R1078:Ep400	UTSW	5	110735522	unclassified	probably benign
R1300:Ep400	UTSW	5	110673560	missense	probably damaging	1.00
R1439:Ep400	UTSW	5	110685478	missense	unknown
R1520:Ep400	UTSW	5	110691778	intron	probably benign
R1529:Ep400	UTSW	5	110739445	missense	probably benign	0.00
R1535:Ep400	UTSW	5	110708166	unclassified	probably benign
R1560:Ep400	UTSW	5	110671106	splice site	probably null
R1587:Ep400	UTSW	5	110726902	missense	probably benign	0.23
R1596:Ep400	UTSW	5	110708861	unclassified	probably benign
R1653:Ep400	UTSW	5	110693174	nonsense	probably null
R1711:Ep400	UTSW	5	110693308	unclassified	probably benign
R1774:Ep400	UTSW	5	110685491	missense	unknown
R1836:Ep400	UTSW	5	110705054	missense	unknown
R1905:Ep400	UTSW	5	110670948	missense	probably damaging	1.00
R1917:Ep400	UTSW	5	110703575	missense	unknown
R2064:Ep400	UTSW	5	110735404	unclassified	probably benign
R2122:Ep400	UTSW	5	110708850	unclassified	probably benign
R2144:Ep400	UTSW	5	110703518	missense	unknown
R2215:Ep400	UTSW	5	110693555	unclassified	probably benign
R2252:Ep400	UTSW	5	110719091	missense	unknown
R2253:Ep400	UTSW	5	110719091	missense	unknown
R2483:Ep400	UTSW	5	110719236	missense	unknown
R2504:Ep400	UTSW	5	110668645	missense	probably damaging	1.00
R2512:Ep400	UTSW	5	110708915	unclassified	probably benign
R2842:Ep400	UTSW	5	110698815	nonsense	probably null
R2920:Ep400	UTSW	5	110755914	missense	probably damaging	1.00
R3082:Ep400	UTSW	5	110693230	unclassified	probably benign
R3151:Ep400	UTSW	5	110703569	missense	unknown
R3552:Ep400	UTSW	5	110729287	missense	unknown
R3623:Ep400	UTSW	5	110719236	missense	unknown
R3779:Ep400	UTSW	5	110691649	missense	unknown
R3923:Ep400	UTSW	5	110756523	missense	possibly damaging	0.55
R4062:Ep400	UTSW	5	110741981	missense	probably benign	0.10
R4508:Ep400	UTSW	5	110703615	missense	unknown
R4584:Ep400	UTSW	5	110733897	unclassified	probably benign
R4585:Ep400	UTSW	5	110753859	missense	probably damaging	1.00
R4586:Ep400	UTSW	5	110753859	missense	probably damaging	1.00
R4807:Ep400	UTSW	5	110695578	splice site	probably null
R4921:Ep400	UTSW	5	110665810	missense	probably damaging	1.00
R4976:Ep400	UTSW	5	110698812	missense	unknown
R4976:Ep400	UTSW	5	110720756	missense	unknown
R5075:Ep400	UTSW	5	110685485	missense	unknown
R5120:Ep400	UTSW	5	110756358	missense	probably damaging	1.00
R5223:Ep400	UTSW	5	110668630	missense	probably damaging	1.00
R5284:Ep400	UTSW	5	110668124	missense	probably damaging	1.00
R5388:Ep400	UTSW	5	110701728	missense	unknown
R5401:Ep400	UTSW	5	110683171	missense	unknown
R5431:Ep400	UTSW	5	110676554	missense	unknown
R5461:Ep400	UTSW	5	110676684	nonsense	probably null
R5568:Ep400	UTSW	5	110756205	missense	probably damaging	1.00
R5650:Ep400	UTSW	5	110695952	critical splice donor site	probably null
R5778:Ep400	UTSW	5	110719584	missense	unknown
R5806:Ep400	UTSW	5	110755554	nonsense	probably null
R5814:Ep400	UTSW	5	110695578	splice site	probably null
R5830:Ep400	UTSW	5	110683996	missense	unknown
R5882:Ep400	UTSW	5	110755587	missense	probably benign	0.00
R5931:Ep400	UTSW	5	110735520	unclassified	probably benign
R5945:Ep400	UTSW	5	110682866	missense	unknown
R5966:Ep400	UTSW	5	110676900	missense	unknown
R5973:Ep400	UTSW	5	110729831	missense	unknown
R5980:Ep400	UTSW	5	110733729	unclassified	probably benign
R6000:Ep400	UTSW	5	110683201	missense	unknown
R6006:Ep400	UTSW	5	110704959	missense	unknown
R6053:Ep400	UTSW	5	110755795	missense	probably benign	0.22
R6145:Ep400	UTSW	5	110756703	missense	possibly damaging	0.95
R6154:Ep400	UTSW	5	110755933	missense	probably damaging	0.97
R6169:Ep400	UTSW	5	110741997	missense	possibly damaging	0.83
R6228:Ep400	UTSW	5	110670942	missense	probably damaging	1.00
R6295:Ep400	UTSW	5	110753809	missense	probably benign	0.00
R6486:Ep400	UTSW	5	110697218	unclassified	probably benign
R6504:Ep400	UTSW	5	110708837	unclassified	probably benign
R6607:Ep400	UTSW	5	110683314	missense	unknown
R6657:Ep400	UTSW	5	110693545	unclassified	probably benign
R6660:Ep400	UTSW	5	110719447	nonsense	probably null
R6741:Ep400	UTSW	5	110676895	missense	unknown
R6933:Ep400	UTSW	5	110665862	missense	probably damaging	1.00
R6937:Ep400	UTSW	5	110711152	unclassified	probably benign
R7069:Ep400	UTSW	5	110668124	missense	probably damaging	1.00
R7103:Ep400	UTSW	5	110733785	missense	unknown
R7156:Ep400	UTSW	5	110685363	missense	unknown
R7272:Ep400	UTSW	5	110755645	nonsense	probably null
R7365:Ep400	UTSW	5	110719614	missense	unknown
R7581:Ep400	UTSW	5	110756025	missense	unknown
R7684:Ep400	UTSW	5	110697352	missense	unknown
R7699:Ep400	UTSW	5	110696032	missense	unknown
R7700:Ep400	UTSW	5	110696032	missense	unknown
R7856:Ep400	UTSW	5	110666584	missense	probably damaging	0.99
R7954:Ep400	UTSW	5	110668733	missense	possibly damaging	0.46
R8098:Ep400	UTSW	5	110693251	missense	unknown
R8108:Ep400	UTSW	5	110687883	missense	unknown
R8260:Ep400	UTSW	5	110755612	nonsense	probably null
R8293:Ep400	UTSW	5	110708892	missense	unknown
R8314:Ep400	UTSW	5	110755753	missense	unknown
R8351:Ep400	UTSW	5	110739334	missense	probably damaging	1.00
R8424:Ep400	UTSW	5	110693278	missense	unknown
R8459:Ep400	UTSW	5	110708891	missense	unknown
R8529:Ep400	UTSW	5	110719236	missense	unknown
R8688:Ep400	UTSW	5	110720819	missense	unknown
R8744:Ep400	UTSW	5	110742059	missense	unknown
R8923:Ep400	UTSW	5	110683998	missense	unknown
R9005:Ep400	UTSW	5	110711093	missense	unknown
R9087:Ep400	UTSW	5	110667564	nonsense	probably null
R9146:Ep400	UTSW	5	110701769	nonsense	probably null
R9383:Ep400	UTSW	5	110685485	missense	unknown
R9479:Ep400	UTSW	5	110729864	missense	unknown
R9496:Ep400	UTSW	5	110707987	missense	unknown
R9582:Ep400	UTSW	5	110676449	critical splice donor site	probably null
R9607:Ep400	UTSW	5	110683939	missense	unknown
R9712:Ep400	UTSW	5	110756643	missense	unknown
R9746:Ep400	UTSW	5	110742006	missense	unknown
X0012:Ep400	UTSW	5	110673196	small deletion	probably benign
X0021:Ep400	UTSW	5	110682864	missense	unknown
Z1176:Ep400	UTSW	5	110756635	missense	unknown
Z1177:Ep400	UTSW	5	110683364	missense	unknown
Z1177:Ep400	UTSW	5	110733743	missense	unknown
Z1188:Ep400	UTSW	5	110755683	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACAGCCCGATTGTTCTGGAC -3'
(R):5'- AGGTTTCCAAGTCCCAAGTTTTG -3'

Sequencing Primer
(F):5'- GGACCCTCCTCTCCAGCAC -3'
(R):5'- CAAGTTTTGGCCCTTGGTGTTAAC -3'

Posted On

2016-06-15