Mutagenetix > Incidental Mutations

Incidental Mutation 'R5122:Grm5'

393345

Institutional Source

Beutler Lab

Gene Symbol

Grm5

Ensembl Gene

ENSMUSG00000049583

Gene Name

glutamate receptor, metabotropic 5

Synonyms

Glu5R, mGluR5, 6430542K11Rik, Gprc1e

MMRRC Submission

042710-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.280) question?

Stock #

R5122 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87584168-88134907 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 88074820 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 773 (I773V)

Ref Sequence

ENSEMBL: ENSMUSP00000114927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107263] [ENSMUST00000125009] [ENSMUST00000155358]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107263
AA Change: I773V

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000102884
Gene: ENSMUSG00000049583
AA Change: I773V

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Pfam:ANF_receptor	67	471	5.4e-97	PFAM
Pfam:Peripla_BP_6	130	332	2.5e-14	PFAM
Pfam:NCD3G	506	557	4.5e-20	PFAM
Pfam:7tm_3	588	824	7.4e-75	PFAM
low complexity region	851	860	N/A	INTRINSIC
low complexity region	929	954	N/A	INTRINSIC
low complexity region	968	987	N/A	INTRINSIC
low complexity region	1046	1056	N/A	INTRINSIC
GluR_Homer-bdg	1121	1171	1.42e-24	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000125009
AA Change: I773V

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000118393
Gene: ENSMUSG00000049583
AA Change: I773V

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Pfam:ANF_receptor	67	471	5.7e-101	PFAM
Pfam:Peripla_BP_6	129	327	5.4e-12	PFAM
Pfam:NCD3G	506	557	3.2e-16	PFAM
Pfam:7tm_3	590	823	3.5e-56	PFAM
low complexity region	851	860	N/A	INTRINSIC
low complexity region	929	954	N/A	INTRINSIC
low complexity region	968	987	N/A	INTRINSIC
low complexity region	1046	1056	N/A	INTRINSIC
GluR_Homer-bdg	1121	1171	1.42e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000155358
AA Change: I773V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000114927
Gene: ENSMUSG00000049583
AA Change: I773V

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Pfam:ANF_receptor	67	471	4.1e-101	PFAM
Pfam:Peripla_BP_6	129	327	2.5e-12	PFAM
Pfam:NCD3G	506	557	9.4e-17	PFAM
Pfam:7tm_3	590	823	1.3e-56	PFAM
low complexity region	851	860	N/A	INTRINSIC
low complexity region	961	986	N/A	INTRINSIC
low complexity region	1000	1019	N/A	INTRINSIC
low complexity region	1078	1088	N/A	INTRINSIC
GluR_Homer-bdg	1153	1203	1.42e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167164
AA Change: I773V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000129181
Gene: ENSMUSG00000049583
AA Change: I773V

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Pfam:ANF_receptor	67	471	4.1e-101	PFAM
Pfam:Peripla_BP_6	129	327	2.5e-12	PFAM
Pfam:NCD3G	506	557	9.4e-17	PFAM
Pfam:7tm_3	590	823	1.3e-56	PFAM
low complexity region	851	860	N/A	INTRINSIC
low complexity region	961	986	N/A	INTRINSIC
low complexity region	1000	1019	N/A	INTRINSIC
low complexity region	1078	1088	N/A	INTRINSIC
GluR_Homer-bdg	1153	1203	1.42e-24	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor 3 protein family. The encoded protein is a metabatropic glutamate receptor, whose signaling activates a phosphatidylinositol-calcium second messenger system. This protein may be involved in the regulation of neural network activity and synaptic plasticity. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. A pseudogene of this gene has been defined on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice have reduced corticostriatal long term potentiation, do not exhibit hyperactivity after cocaine consumption and do not self-administer cocaine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 37,034,757		probably null	Het
Acan	T	C	7: 79,100,661	S1727P	probably damaging	Het
Actr8	A	T	14: 29,982,715	K57N	possibly damaging	Het
Bcan	G	T	3: 87,994,207	S396Y	probably damaging	Het
Bmp2k	A	G	5: 97,087,015		probably benign	Het
Cd274	A	G	19: 29,380,565	H219R	possibly damaging	Het
Cdc16	A	T	8: 13,764,570	Y118F	probably damaging	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Chchd3	T	C	6: 32,968,305	R89G	probably benign	Het
Clstn2	C	T	9: 97,461,421	V658M	probably damaging	Het
Cpt1b	A	G	15: 89,424,023	S160P	probably benign	Het
Crym	T	C	7: 120,195,495	N167S	probably benign	Het
Dhx16	T	A	17: 35,883,310	Y438N	probably damaging	Het
Dnah12	A	G	14: 26,718,000	R536G	probably benign	Het
Dnajc11	A	G	4: 151,976,997	D382G	possibly damaging	Het
Dync1h1	G	A	12: 110,629,680	G1547D	probably damaging	Het
Eml3	T	A	19: 8,937,696		probably null	Het
Ep400	G	A	5: 110,668,170	P2799S	probably damaging	Het
Ephb6	T	C	6: 41,613,404	V30A	probably benign	Het
Fam53b	T	A	7: 132,779,262		probably benign	Het
Fcrl1	A	G	3: 87,385,774	K246R	probably benign	Het
Focad	G	A	4: 88,407,365		probably null	Het
Glipr1l2	T	C	10: 112,107,056	I272T	possibly damaging	Het
Gm597	A	G	1: 28,780,060	S47P	probably benign	Het
Gm8104	A	G	14: 43,109,093	I101V	probably benign	Het
Hyal1	A	T	9: 107,578,069	T193S	probably benign	Het
Igkv10-94	C	A	6: 68,704,671	G62*	probably null	Het
Itsn1	A	G	16: 91,893,844		probably benign	Het
Kank4	A	G	4: 98,756,567	S983P	probably damaging	Het
Krtap16-1	C	A	11: 99,985,697	V294F	probably damaging	Het
Lama3	T	G	18: 12,539,766	V866G	possibly damaging	Het
Lrba	C	T	3: 86,349,154	R1268*	probably null	Het
Lrriq1	C	T	10: 103,187,453	V984I	probably damaging	Het
Macf1	A	C	4: 123,452,292	V4136G	probably damaging	Het
Mdn1	A	T	4: 32,670,593	E419D	probably damaging	Het
Nedd4l	A	G	18: 65,191,447	Y473C	probably damaging	Het
Nod2	G	T	8: 88,664,120	D330Y	probably damaging	Het
Nt5c2	C	T	19: 46,889,921	C458Y	probably damaging	Het
Numa1	T	C	7: 102,013,769	I681T	probably damaging	Het
Olfr713	C	A	7: 107,036,848	S231*	probably null	Het
Papolg	C	T	11: 23,867,501		probably null	Het
Parn	A	G	16: 13,654,447		probably null	Het
Pgap2	T	C	7: 102,231,391	F42S	probably damaging	Het
Phf11d	A	T	14: 59,353,344	M188K	possibly damaging	Het
Pofut2	G	C	10: 77,268,565	R392P	probably damaging	Het
Prpf18	T	C	2: 4,643,709	D102G	probably damaging	Het
Rreb1	T	A	13: 37,930,768	I701N	probably benign	Het
Slc26a5	T	C	5: 21,847,196	K45R	probably damaging	Het
Slc8a3	A	G	12: 81,314,258		probably null	Het
Slf1	T	A	13: 77,049,987	M723L	probably benign	Het
Sra1	T	C	18: 36,667,594	T187A	probably benign	Het
Stk17b	A	C	1: 53,776,558	N27K	probably damaging	Het
Tbc1d9	T	A	8: 83,236,543	Y295N	probably damaging	Het
Tubgcp6	A	G	15: 89,116,103	V353A	probably damaging	Het
Unc80	A	T	1: 66,679,590	T2991S	possibly damaging	Het
Urb1	G	A	16: 90,752,095	R2242*	probably null	Het
Vasp	T	C	7: 19,264,772	N20S	probably benign	Het
Zfp263	A	G	16: 3,749,855	H390R	probably damaging	Het

Other mutations in Grm5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Grm5	APN	7	88130781	missense	probably benign	0.00
IGL00970:Grm5	APN	7	87803896	missense	probably damaging	0.97
IGL01286:Grm5	APN	7	87602565	missense	probably benign	0.00
IGL01307:Grm5	APN	7	88075012	missense	probably damaging	1.00
IGL01603:Grm5	APN	7	87603178	missense	probably damaging	1.00
IGL01646:Grm5	APN	7	88040059	missense	probably damaging	1.00
IGL01705:Grm5	APN	7	88130046	missense	possibly damaging	0.59
IGL02184:Grm5	APN	7	88026442	missense	probably damaging	0.98
IGL02504:Grm5	APN	7	88130772	missense	probably benign
IGL02689:Grm5	APN	7	87602710	missense	probably damaging	1.00
IGL02725:Grm5	APN	7	88074665	missense	probably damaging	1.00
IGL02851:Grm5	APN	7	88074710	missense	probably damaging	0.98
IGL03106:Grm5	APN	7	88036070	missense	probably damaging	1.00
IGL03257:Grm5	APN	7	87602898	missense	possibly damaging	0.69
IGL03291:Grm5	APN	7	88130796	missense	probably damaging	1.00
R0078:Grm5	UTSW	7	88074977	missense	probably damaging	1.00
R0314:Grm5	UTSW	7	87602955	missense	probably damaging	0.97
R0318:Grm5	UTSW	7	87602967	missense	probably damaging	0.99
R0364:Grm5	UTSW	7	88074386	missense	probably damaging	1.00
R0380:Grm5	UTSW	7	88074376	missense	possibly damaging	0.92
R0454:Grm5	UTSW	7	88130789	missense	probably damaging	1.00
R0494:Grm5	UTSW	7	88130781	missense	probably benign	0.00
R0562:Grm5	UTSW	7	87603019	missense	probably damaging	1.00
R1695:Grm5	UTSW	7	88036103	missense	possibly damaging	0.47
R2012:Grm5	UTSW	7	88074872	missense	probably damaging	1.00
R2384:Grm5	UTSW	7	87602728	missense	probably damaging	1.00
R2510:Grm5	UTSW	7	88036091	missense	probably benign	0.21
R2870:Grm5	UTSW	7	87602722	missense	possibly damaging	0.85
R2870:Grm5	UTSW	7	87602722	missense	possibly damaging	0.85
R3861:Grm5	UTSW	7	88129994	missense	possibly damaging	0.94
R4451:Grm5	UTSW	7	88075132	critical splice donor site	probably null
R4626:Grm5	UTSW	7	88130153	missense	probably damaging	1.00
R4728:Grm5	UTSW	7	87975288	missense	probably damaging	1.00
R4914:Grm5	UTSW	7	88130129	missense	probably benign	0.00
R5352:Grm5	UTSW	7	88074850	missense	probably damaging	1.00
R5361:Grm5	UTSW	7	88074496	missense	probably damaging	1.00
R5684:Grm5	UTSW	7	88130645	missense	probably benign
R5715:Grm5	UTSW	7	88130256	missense	probably benign	0.05
R5759:Grm5	UTSW	7	88026600	missense	probably damaging	0.96
R5844:Grm5	UTSW	7	87804024	missense	possibly damaging	0.88
R5889:Grm5	UTSW	7	87603073	missense	probably damaging	1.00
R6048:Grm5	UTSW	7	88026550	missense	probably damaging	1.00
R6145:Grm5	UTSW	7	88026601	missense	probably damaging	1.00
R6232:Grm5	UTSW	7	87602430	unclassified	probably benign
R6972:Grm5	UTSW	7	87602923	missense	probably benign	0.02
R7072:Grm5	UTSW	7	88074304	missense	probably damaging	1.00
R7258:Grm5	UTSW	7	88074706	missense	probably damaging	0.96
R7316:Grm5	UTSW	7	87975265	missense	probably benign
R7434:Grm5	UTSW	7	88130474	missense	probably benign	0.10
R7521:Grm5	UTSW	7	88074272	missense	possibly damaging	0.86
R7616:Grm5	UTSW	7	88116201	missense	probably benign
R7631:Grm5	UTSW	7	87975305	missense	probably damaging	1.00
R7655:Grm5	UTSW	7	88130251	missense	probably benign	0.00
R7656:Grm5	UTSW	7	88130251	missense	probably benign	0.00
R7739:Grm5	UTSW	7	88130058	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- TGGCCCTCTTTATCATGGAGC -3'
(R):5'- CACTGTAGAGGTTGTGAAGGC -3'

Sequencing Primer
(F):5'- TCATGGAGCCTCCGGATATAATGC -3'
(R):5'- AGGTTGTGAAGGCGCTGC -3'

Posted On

2016-06-15