Incidental Mutation 'R0445:Cdkn3'
ID39335
Institutional Source Beutler Lab
Gene Symbol Cdkn3
Ensembl Gene ENSMUSG00000037628
Gene Namecyclin-dependent kinase inhibitor 3
Synonyms2410006H10Rik, KAP
MMRRC Submission 038646-MU
Accession Numbers

Ncbi RefSeq: NM_028222.1; MGI:1919641

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0445 (G1)
Quality Score188
Status Validated
Chromosome14
Chromosomal Location46760541-46771669 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 46767400 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000070575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067426] [ENSMUST00000227149] [ENSMUST00000228106]
Predicted Effect probably null
Transcript: ENSMUST00000067426
SMART Domains Protein: ENSMUSP00000070575
Gene: ENSMUSG00000037628

DomainStartEndE-ValueType
PTPc_DSPc 7 197 2.8e-3 SMART
low complexity region 199 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226621
Predicted Effect probably benign
Transcript: ENSMUST00000227149
AA Change: Y140H

PolyPhen 2 Score 0.179 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000228106
AA Change: Y140H

PolyPhen 2 Score 0.179 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.538 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dual specificity protein phosphatase family. It was identified as a cyclin-dependent kinase inhibitor, and has been shown to interact with, and dephosphorylate CDK2 kinase, thus prevent the activation of CDK2 kinase. This gene was reported to be deleted, mutated, or overexpressed in several kinds of cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A C 17: 48,090,022 probably null Het
4932438A13Rik T C 3: 37,000,065 V3111A probably damaging Het
A2m C T 6: 121,657,955 T687I probably damaging Het
Acsbg1 A G 9: 54,615,895 S483P probably damaging Het
Adam22 T A 5: 8,180,591 probably benign Het
Aggf1 A G 13: 95,354,001 V595A possibly damaging Het
Aplf A T 6: 87,663,752 L71I probably damaging Het
Arid3c G T 4: 41,725,172 P292T probably benign Het
Brms1l T A 12: 55,861,406 Y213* probably null Het
C87436 T A 6: 86,449,850 S332T possibly damaging Het
Cad G A 5: 31,072,709 A1454T probably benign Het
Cnot1 A G 8: 95,760,208 C624R probably damaging Het
Cntnap5c A T 17: 58,104,743 I541F probably benign Het
Cyhr1 T C 15: 76,648,257 H217R probably damaging Het
Dennd1b A G 1: 139,167,765 probably benign Het
Dscam A T 16: 96,772,503 I753N probably damaging Het
Eef2 C CN 10: 81,178,770 probably null Het
Epg5 T A 18: 78,014,184 V1826D possibly damaging Het
Epha8 T C 4: 136,932,400 Y755C probably damaging Het
Esco1 A T 18: 10,574,989 N694K probably damaging Het
Fermt3 T C 19: 7,003,299 H300R probably benign Het
Galnt5 C A 2: 57,998,950 F187L probably benign Het
Gm17067 A G 7: 42,708,622 I152T probably benign Het
Gnb3 T C 6: 124,837,255 D154G possibly damaging Het
Gpr155 G A 2: 73,370,144 probably benign Het
Hdac3 A G 18: 37,943,724 I240T probably damaging Het
Ifitm1 A T 7: 140,968,441 probably null Het
Kif1b A T 4: 149,188,009 L1455Q probably benign Het
Krt1 A C 15: 101,847,621 L388R probably damaging Het
Lrp1 T A 10: 127,590,636 K635* probably null Het
Map3k2 A G 18: 32,217,210 Y371C probably damaging Het
Mcu T C 10: 59,456,645 probably benign Het
Mkrn1 C T 6: 39,404,854 V167I probably benign Het
Mrpl9 T A 3: 94,444,891 probably benign Het
Naip2 T C 13: 100,161,887 Y547C possibly damaging Het
Nup88 G A 11: 70,947,729 T487I probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Obscn C T 11: 58,999,335 R7457H unknown Het
Olfr1383 T A 11: 49,523,957 V78E probably damaging Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Paf1 T C 7: 28,395,688 S118P probably damaging Het
Parp4 T A 14: 56,602,748 probably null Het
Pcdh15 A T 10: 74,342,549 Y157F probably damaging Het
Pex10 G A 4: 155,069,074 probably null Het
Phrf1 C T 7: 141,247,331 probably benign Het
Polr3a G T 14: 24,454,921 D1090E probably benign Het
Ppfia4 A C 1: 134,327,289 L276R probably benign Het
Rdh16f1 T C 10: 127,790,867 L263S probably benign Het
Ryr3 T C 2: 112,866,054 D967G probably benign Het
Shc1 G T 3: 89,426,537 A226S probably damaging Het
Slc4a1 A G 11: 102,354,366 V585A probably benign Het
Stk38l T A 6: 146,775,686 S461T probably benign Het
Tbkbp1 A T 11: 97,149,469 S40T probably damaging Het
Tet1 A G 10: 62,879,941 M25T probably benign Het
Themis A G 10: 28,782,011 R192G probably damaging Het
Tmem144 T C 3: 79,825,354 T206A probably benign Het
Tmem74b G A 2: 151,706,959 R202H probably damaging Het
Trpm1 T C 7: 64,244,842 probably benign Het
Vars A G 17: 35,011,809 H557R probably benign Het
Zbtb12 C A 17: 34,896,301 A354E possibly damaging Het
Zfp143 A T 7: 110,061,117 probably benign Het
Other mutations in Cdkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
E0374:Cdkn3 UTSW 14 46767173 splice site probably null
R0033:Cdkn3 UTSW 14 46768872 nonsense probably null
R0033:Cdkn3 UTSW 14 46768872 nonsense probably null
R1912:Cdkn3 UTSW 14 46769834 critical splice acceptor site probably null
R3176:Cdkn3 UTSW 14 46771477 unclassified probably benign
R3276:Cdkn3 UTSW 14 46771477 unclassified probably benign
R4941:Cdkn3 UTSW 14 46769863 missense possibly damaging 0.90
R5344:Cdkn3 UTSW 14 46767350 missense possibly damaging 0.94
R5964:Cdkn3 UTSW 14 46767217 missense probably null 1.00
R6039:Cdkn3 UTSW 14 46769916 missense probably damaging 1.00
R6039:Cdkn3 UTSW 14 46769916 missense probably damaging 1.00
R7073:Cdkn3 UTSW 14 46767190 missense possibly damaging 0.79
R7234:Cdkn3 UTSW 14 46771461 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTCCCAAACCTTCTGGACCTCTAC -3'
(R):5'- TTCCTTGCTACTGAAAAGGCTGAGATG -3'

Sequencing Primer
(F):5'- TTCTGGACCTCTACCAACAATATGG -3'
(R):5'- GGAGAAATGTCTCTACTCTAAACAC -3'
Posted On2013-05-23