Incidental Mutation 'R5122:Lrriq1'
ID 393356
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Name leucine-rich repeats and IQ motif containing 1
Synonyms Gm1557, LOC380658, 4930503E15Rik
MMRRC Submission 042710-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R5122 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 102881892-103072183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103023314 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 984 (V984I)
Ref Sequence ENSEMBL: ENSMUSP00000131419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166240]
AlphaFold Q0P5X1
Predicted Effect probably damaging
Transcript: ENSMUST00000166240
AA Change: V984I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: V984I

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 78,750,409 (GRCm39) S1727P probably damaging Het
Actr8 A T 14: 29,704,672 (GRCm39) K57N possibly damaging Het
Bcan G T 3: 87,901,514 (GRCm39) S396Y probably damaging Het
Bltp1 A G 3: 37,088,906 (GRCm39) probably null Het
Bmp2k A G 5: 97,234,874 (GRCm39) probably benign Het
Cd274 A G 19: 29,357,965 (GRCm39) H219R possibly damaging Het
Cdc16 A T 8: 13,814,570 (GRCm39) Y118F probably damaging Het
Cdc23 C A 18: 34,784,742 (GRCm39) V7L unknown Het
Chchd3 T C 6: 32,945,240 (GRCm39) R89G probably benign Het
Clstn2 C T 9: 97,343,474 (GRCm39) V658M probably damaging Het
Cpt1b A G 15: 89,308,226 (GRCm39) S160P probably benign Het
Crym T C 7: 119,794,718 (GRCm39) N167S probably benign Het
Dhx16 T A 17: 36,194,202 (GRCm39) Y438N probably damaging Het
Dnah12 A G 14: 26,439,155 (GRCm39) R536G probably benign Het
Dnajc11 A G 4: 152,061,454 (GRCm39) D382G possibly damaging Het
Dync1h1 G A 12: 110,596,114 (GRCm39) G1547D probably damaging Het
Eml3 T A 19: 8,915,060 (GRCm39) probably null Het
Ep400 G A 5: 110,816,036 (GRCm39) P2799S probably damaging Het
Ephb6 T C 6: 41,590,338 (GRCm39) V30A probably benign Het
Fam53b T A 7: 132,380,991 (GRCm39) probably benign Het
Fcrl1 A G 3: 87,293,081 (GRCm39) K246R probably benign Het
Focad G A 4: 88,325,602 (GRCm39) probably null Het
Glipr1l2 T C 10: 111,942,961 (GRCm39) I272T possibly damaging Het
Gm8104 A G 14: 42,966,550 (GRCm39) I101V probably benign Het
Grm5 A G 7: 87,724,028 (GRCm39) I773V probably damaging Het
Hyal1 A T 9: 107,455,268 (GRCm39) T193S probably benign Het
Igkv10-94 C A 6: 68,681,655 (GRCm39) G62* probably null Het
Itsn1 A G 16: 91,690,732 (GRCm39) probably benign Het
Kank4 A G 4: 98,644,804 (GRCm39) S983P probably damaging Het
Krtap16-1 C A 11: 99,876,523 (GRCm39) V294F probably damaging Het
Lama3 T G 18: 12,672,823 (GRCm39) V866G possibly damaging Het
Lrba C T 3: 86,256,461 (GRCm39) R1268* probably null Het
Macf1 A C 4: 123,346,085 (GRCm39) V4136G probably damaging Het
Mdn1 A T 4: 32,670,593 (GRCm39) E419D probably damaging Het
Nedd4l A G 18: 65,324,518 (GRCm39) Y473C probably damaging Het
Nod2 G T 8: 89,390,748 (GRCm39) D330Y probably damaging Het
Nt5c2 C T 19: 46,878,360 (GRCm39) C458Y probably damaging Het
Numa1 T C 7: 101,662,976 (GRCm39) I681T probably damaging Het
Or10a5 C A 7: 106,636,055 (GRCm39) S231* probably null Het
Papolg C T 11: 23,817,501 (GRCm39) probably null Het
Parn A G 16: 13,472,311 (GRCm39) probably null Het
Pgap2 T C 7: 101,880,598 (GRCm39) F42S probably damaging Het
Phf11d A T 14: 59,590,793 (GRCm39) M188K possibly damaging Het
Pofut2 G C 10: 77,104,399 (GRCm39) R392P probably damaging Het
Prpf18 T C 2: 4,648,520 (GRCm39) D102G probably damaging Het
Rreb1 T A 13: 38,114,744 (GRCm39) I701N probably benign Het
Slc26a5 T C 5: 22,052,194 (GRCm39) K45R probably damaging Het
Slc8a3 A G 12: 81,361,032 (GRCm39) probably null Het
Slf1 T A 13: 77,198,106 (GRCm39) M723L probably benign Het
Spata31e5 A G 1: 28,819,141 (GRCm39) S47P probably benign Het
Sra1 T C 18: 36,800,647 (GRCm39) T187A probably benign Het
Stk17b A C 1: 53,815,717 (GRCm39) N27K probably damaging Het
Tbc1d9 T A 8: 83,963,172 (GRCm39) Y295N probably damaging Het
Tubgcp6 A G 15: 89,000,306 (GRCm39) V353A probably damaging Het
Unc80 A T 1: 66,718,749 (GRCm39) T2991S possibly damaging Het
Urb1 G A 16: 90,548,983 (GRCm39) R2242* probably null Het
Vasp T C 7: 18,998,697 (GRCm39) N20S probably benign Het
Zfp263 A G 16: 3,567,719 (GRCm39) H390R probably damaging Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 102,997,757 (GRCm39) missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103,053,977 (GRCm39) nonsense probably null
IGL01637:Lrriq1 APN 10 103,051,489 (GRCm39) missense probably benign
IGL02019:Lrriq1 APN 10 103,014,661 (GRCm39) missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103,006,340 (GRCm39) missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103,060,802 (GRCm39) missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103,070,024 (GRCm39) splice site probably benign
IGL02408:Lrriq1 APN 10 102,982,142 (GRCm39) missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103,036,500 (GRCm39) missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103,050,880 (GRCm39) missense probably benign 0.02
IGL02558:Lrriq1 APN 10 102,982,144 (GRCm39) missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 102,980,409 (GRCm39) missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103,057,322 (GRCm39) critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103,063,057 (GRCm39) missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 102,907,055 (GRCm39) missense probably benign 0.26
R0050:Lrriq1 UTSW 10 102,904,792 (GRCm39) missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 102,904,792 (GRCm39) missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 102,899,279 (GRCm39) missense probably benign 0.02
R0068:Lrriq1 UTSW 10 102,899,279 (GRCm39) missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103,006,281 (GRCm39) critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103,051,634 (GRCm39) missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103,057,150 (GRCm39) missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 102,904,829 (GRCm39) splice site probably null
R0522:Lrriq1 UTSW 10 102,997,638 (GRCm39) missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103,069,905 (GRCm39) missense probably benign
R1220:Lrriq1 UTSW 10 102,906,990 (GRCm39) missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103,069,998 (GRCm39) missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103,069,998 (GRCm39) missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103,038,376 (GRCm39) splice site probably benign
R1642:Lrriq1 UTSW 10 103,050,317 (GRCm39) missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103,050,685 (GRCm39) missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103,006,509 (GRCm39) nonsense probably null
R1830:Lrriq1 UTSW 10 102,997,620 (GRCm39) missense probably benign
R1843:Lrriq1 UTSW 10 103,063,034 (GRCm39) splice site probably null
R2128:Lrriq1 UTSW 10 103,050,718 (GRCm39) missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103,050,718 (GRCm39) missense probably benign 0.01
R2199:Lrriq1 UTSW 10 102,904,774 (GRCm39) missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103,025,848 (GRCm39) missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103,038,242 (GRCm39) missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103,063,111 (GRCm39) missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103,063,111 (GRCm39) missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103,050,536 (GRCm39) missense probably benign 0.00
R2939:Lrriq1 UTSW 10 102,980,750 (GRCm39) missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R3081:Lrriq1 UTSW 10 102,980,750 (GRCm39) missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103,006,294 (GRCm39) missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103,006,717 (GRCm39) missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103,051,972 (GRCm39) missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103,051,972 (GRCm39) missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103,051,967 (GRCm39) missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103,038,225 (GRCm39) missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103,057,288 (GRCm39) missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103,036,424 (GRCm39) nonsense probably null
R4663:Lrriq1 UTSW 10 102,899,273 (GRCm39) missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103,051,610 (GRCm39) missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103,006,327 (GRCm39) missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103,057,179 (GRCm39) missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103,057,179 (GRCm39) missense probably benign 0.02
R4815:Lrriq1 UTSW 10 102,980,739 (GRCm39) missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103,014,649 (GRCm39) missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103,069,899 (GRCm39) missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 102,997,613 (GRCm39) missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103,036,420 (GRCm39) missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103,036,420 (GRCm39) missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103,025,784 (GRCm39) missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103,025,784 (GRCm39) missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103,051,206 (GRCm39) missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103,050,448 (GRCm39) missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103,006,457 (GRCm39) missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103,051,301 (GRCm39) missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103,009,236 (GRCm39) missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103,057,243 (GRCm39) nonsense probably null
R6008:Lrriq1 UTSW 10 103,006,325 (GRCm39) missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103,051,395 (GRCm39) missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103,051,618 (GRCm39) missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103,051,312 (GRCm39) missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103,009,254 (GRCm39) missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103,036,559 (GRCm39) missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103,063,045 (GRCm39) missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103,057,293 (GRCm39) missense probably benign 0.06
R6719:Lrriq1 UTSW 10 102,906,977 (GRCm39) missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103,017,750 (GRCm39) critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103,050,800 (GRCm39) missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103,023,319 (GRCm39) missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103,060,826 (GRCm39) missense probably benign
R7241:Lrriq1 UTSW 10 103,051,834 (GRCm39) missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103,059,611 (GRCm39) missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103,051,877 (GRCm39) missense probably benign 0.00
R7402:Lrriq1 UTSW 10 103,057,185 (GRCm39) missense possibly damaging 0.87
R7439:Lrriq1 UTSW 10 103,050,380 (GRCm39) missense probably benign 0.21
R7585:Lrriq1 UTSW 10 103,050,807 (GRCm39) missense possibly damaging 0.93
R7611:Lrriq1 UTSW 10 103,036,432 (GRCm39) missense possibly damaging 0.54
R7634:Lrriq1 UTSW 10 103,036,462 (GRCm39) missense probably damaging 1.00
R7767:Lrriq1 UTSW 10 103,051,815 (GRCm39) missense probably damaging 0.99
R7809:Lrriq1 UTSW 10 103,051,678 (GRCm39) missense probably damaging 0.99
R7910:Lrriq1 UTSW 10 103,051,055 (GRCm39) nonsense probably null
R8131:Lrriq1 UTSW 10 103,051,572 (GRCm39) missense possibly damaging 0.57
R8156:Lrriq1 UTSW 10 102,992,196 (GRCm39) critical splice donor site probably null
R8211:Lrriq1 UTSW 10 103,006,408 (GRCm39) missense probably damaging 1.00
R8304:Lrriq1 UTSW 10 103,069,929 (GRCm39) missense possibly damaging 0.57
R8487:Lrriq1 UTSW 10 103,050,914 (GRCm39) missense probably damaging 0.98
R8500:Lrriq1 UTSW 10 102,882,016 (GRCm39) missense
R9013:Lrriq1 UTSW 10 103,050,931 (GRCm39) missense probably damaging 1.00
R9099:Lrriq1 UTSW 10 103,051,864 (GRCm39) missense probably damaging 0.98
R9155:Lrriq1 UTSW 10 103,050,640 (GRCm39) missense probably benign 0.03
R9320:Lrriq1 UTSW 10 103,057,144 (GRCm39) missense probably benign
R9384:Lrriq1 UTSW 10 103,006,458 (GRCm39) missense probably benign 0.00
R9469:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R9585:Lrriq1 UTSW 10 103,051,250 (GRCm39) missense probably benign
R9706:Lrriq1 UTSW 10 102,881,902 (GRCm39) missense
R9780:Lrriq1 UTSW 10 103,025,824 (GRCm39) missense probably damaging 1.00
X0026:Lrriq1 UTSW 10 103,051,565 (GRCm39) nonsense probably null
Z1088:Lrriq1 UTSW 10 103,038,307 (GRCm39) missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103,069,946 (GRCm39) missense probably damaging 0.99
Z1176:Lrriq1 UTSW 10 103,038,221 (GRCm39) missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103,038,220 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAAGTCTAGGGTTAGCTTGCCAC -3'
(R):5'- ACGTATGTTATAAGCTGGACCAC -3'

Sequencing Primer
(F):5'- AGTTGTTTGTATACATCACACCAC -3'
(R):5'- AGCTGGACCACAATTATCTATTTTG -3'
Posted On 2016-06-15