Incidental Mutation 'R5122:Slf1'
ID393362
Institutional Source Beutler Lab
Gene Symbol Slf1
Ensembl Gene ENSMUSG00000021597
Gene NameSMC5-SMC6 complex localization factor 1
Synonyms2700017A04Rik, Brctx, Brctd1, C730024G01Rik, Ankrd32
MMRRC Submission 042710-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5122 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location77043088-77135473 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77049987 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 723 (M723L)
Ref Sequence ENSEMBL: ENSMUSP00000118312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151524]
Predicted Effect probably benign
Transcript: ENSMUST00000151524
AA Change: M723L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000118312
Gene: ENSMUSG00000021597
AA Change: M723L

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
BRCT 121 199 2.12e1 SMART
low complexity region 260 273 N/A INTRINSIC
low complexity region 527 541 N/A INTRINSIC
low complexity region 765 785 N/A INTRINSIC
ANK 802 832 1.52e0 SMART
ANK 836 865 4.32e-5 SMART
ANK 870 900 2.07e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162005
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are developmentally normal and fertile with no pathological abnormalities or defects in T-cell development and genomic stability. Mutant MEFs grow at a normal rate and are not more sensitive to DNA-damaging agents while thymocytes donot show any major cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,034,757 probably null Het
Acan T C 7: 79,100,661 S1727P probably damaging Het
Actr8 A T 14: 29,982,715 K57N possibly damaging Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Bmp2k A G 5: 97,087,015 probably benign Het
Cd274 A G 19: 29,380,565 H219R possibly damaging Het
Cdc16 A T 8: 13,764,570 Y118F probably damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Chchd3 T C 6: 32,968,305 R89G probably benign Het
Clstn2 C T 9: 97,461,421 V658M probably damaging Het
Cpt1b A G 15: 89,424,023 S160P probably benign Het
Crym T C 7: 120,195,495 N167S probably benign Het
Dhx16 T A 17: 35,883,310 Y438N probably damaging Het
Dnah12 A G 14: 26,718,000 R536G probably benign Het
Dnajc11 A G 4: 151,976,997 D382G possibly damaging Het
Dync1h1 G A 12: 110,629,680 G1547D probably damaging Het
Eml3 T A 19: 8,937,696 probably null Het
Ep400 G A 5: 110,668,170 P2799S probably damaging Het
Ephb6 T C 6: 41,613,404 V30A probably benign Het
Fam53b T A 7: 132,779,262 probably benign Het
Fcrl1 A G 3: 87,385,774 K246R probably benign Het
Focad G A 4: 88,407,365 probably null Het
Glipr1l2 T C 10: 112,107,056 I272T possibly damaging Het
Gm597 A G 1: 28,780,060 S47P probably benign Het
Gm8104 A G 14: 43,109,093 I101V probably benign Het
Grm5 A G 7: 88,074,820 I773V probably damaging Het
Hyal1 A T 9: 107,578,069 T193S probably benign Het
Igkv10-94 C A 6: 68,704,671 G62* probably null Het
Itsn1 A G 16: 91,893,844 probably benign Het
Kank4 A G 4: 98,756,567 S983P probably damaging Het
Krtap16-1 C A 11: 99,985,697 V294F probably damaging Het
Lama3 T G 18: 12,539,766 V866G possibly damaging Het
Lrba C T 3: 86,349,154 R1268* probably null Het
Lrriq1 C T 10: 103,187,453 V984I probably damaging Het
Macf1 A C 4: 123,452,292 V4136G probably damaging Het
Mdn1 A T 4: 32,670,593 E419D probably damaging Het
Nedd4l A G 18: 65,191,447 Y473C probably damaging Het
Nod2 G T 8: 88,664,120 D330Y probably damaging Het
Nt5c2 C T 19: 46,889,921 C458Y probably damaging Het
Numa1 T C 7: 102,013,769 I681T probably damaging Het
Olfr713 C A 7: 107,036,848 S231* probably null Het
Papolg C T 11: 23,867,501 probably null Het
Parn A G 16: 13,654,447 probably null Het
Pgap2 T C 7: 102,231,391 F42S probably damaging Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Pofut2 G C 10: 77,268,565 R392P probably damaging Het
Prpf18 T C 2: 4,643,709 D102G probably damaging Het
Rreb1 T A 13: 37,930,768 I701N probably benign Het
Slc26a5 T C 5: 21,847,196 K45R probably damaging Het
Slc8a3 A G 12: 81,314,258 probably null Het
Sra1 T C 18: 36,667,594 T187A probably benign Het
Stk17b A C 1: 53,776,558 N27K probably damaging Het
Tbc1d9 T A 8: 83,236,543 Y295N probably damaging Het
Tubgcp6 A G 15: 89,116,103 V353A probably damaging Het
Unc80 A T 1: 66,679,590 T2991S possibly damaging Het
Urb1 G A 16: 90,752,095 R2242* probably null Het
Vasp T C 7: 19,264,772 N20S probably benign Het
Zfp263 A G 16: 3,749,855 H390R probably damaging Het
Other mutations in Slf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slf1 APN 13 77043947 missense possibly damaging 0.95
IGL01105:Slf1 APN 13 77100912 unclassified probably benign
IGL01108:Slf1 APN 13 77125475 splice site probably benign
IGL01149:Slf1 APN 13 77112648 missense probably damaging 0.99
IGL01642:Slf1 APN 13 77049915 missense probably benign 0.00
IGL01757:Slf1 APN 13 77084440 missense probably benign
IGL01887:Slf1 APN 13 77100982 missense probably benign 0.02
IGL02323:Slf1 APN 13 77051294 missense possibly damaging 0.87
IGL02861:Slf1 APN 13 77126359 splice site probably benign
IGL02971:Slf1 APN 13 77047104 splice site probably benign
IGL03088:Slf1 APN 13 77084435 missense probably damaging 1.00
IGL03215:Slf1 APN 13 77049977 missense probably benign 0.00
IGL02980:Slf1 UTSW 13 77044004 missense possibly damaging 0.92
PIT1430001:Slf1 UTSW 13 77050050 splice site probably benign
R0036:Slf1 UTSW 13 77100951 missense probably benign 0.02
R0036:Slf1 UTSW 13 77100951 missense probably benign 0.02
R0125:Slf1 UTSW 13 77043745 missense probably benign 0.02
R0230:Slf1 UTSW 13 77112748 intron probably benign
R0244:Slf1 UTSW 13 77126632 nonsense probably null
R0395:Slf1 UTSW 13 77105969 splice site probably benign
R0614:Slf1 UTSW 13 77049114 missense probably benign 0.10
R0661:Slf1 UTSW 13 77083596 missense probably benign 0.31
R0837:Slf1 UTSW 13 77100948 unclassified probably null
R0945:Slf1 UTSW 13 77103471 unclassified probably benign
R1282:Slf1 UTSW 13 77043840 missense probably damaging 0.97
R1365:Slf1 UTSW 13 77126371 missense probably damaging 1.00
R1449:Slf1 UTSW 13 77083449 missense probably damaging 1.00
R1646:Slf1 UTSW 13 77066648 nonsense probably null
R2071:Slf1 UTSW 13 77104624 missense probably benign 0.02
R2141:Slf1 UTSW 13 77049219 critical splice acceptor site probably null
R2217:Slf1 UTSW 13 77046706 critical splice acceptor site probably null
R2397:Slf1 UTSW 13 77103583 nonsense probably null
R2520:Slf1 UTSW 13 77051265 missense probably damaging 1.00
R3108:Slf1 UTSW 13 77126721 splice site probably benign
R4178:Slf1 UTSW 13 77043569 missense probably damaging 1.00
R4663:Slf1 UTSW 13 77126604 missense probably damaging 1.00
R4730:Slf1 UTSW 13 77046632 missense probably damaging 1.00
R4910:Slf1 UTSW 13 77043880 missense probably benign 0.14
R4912:Slf1 UTSW 13 77051294 missense probably damaging 1.00
R5269:Slf1 UTSW 13 77104581 missense probably benign 0.33
R5336:Slf1 UTSW 13 77106010 makesense probably null
R5346:Slf1 UTSW 13 77092371 missense probably benign 0.00
R5445:Slf1 UTSW 13 77091204 missense probably benign 0.10
R5568:Slf1 UTSW 13 77046704 missense probably damaging 1.00
R5622:Slf1 UTSW 13 77049971 missense probably benign 0.14
R5685:Slf1 UTSW 13 77083479 missense possibly damaging 0.88
R5792:Slf1 UTSW 13 77066737 missense probably benign 0.03
R5856:Slf1 UTSW 13 77106087 missense possibly damaging 0.63
R6109:Slf1 UTSW 13 77126680 missense probably damaging 0.99
R6245:Slf1 UTSW 13 77084383 missense probably damaging 1.00
R6338:Slf1 UTSW 13 77084462 critical splice acceptor site probably null
R6438:Slf1 UTSW 13 77066606 missense probably damaging 1.00
R6487:Slf1 UTSW 13 77066617 missense probably damaging 1.00
R6597:Slf1 UTSW 13 77049129 missense probably benign 0.01
R6600:Slf1 UTSW 13 77083536 missense probably benign 0.00
R6661:Slf1 UTSW 13 77043845 missense probably damaging 1.00
R7268:Slf1 UTSW 13 77066707 missense probably damaging 1.00
R7308:Slf1 UTSW 13 77051168 missense probably benign 0.19
R7355:Slf1 UTSW 13 77091303 missense probably damaging 1.00
R7546:Slf1 UTSW 13 77049192 missense probably benign
X0018:Slf1 UTSW 13 77051238 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTAGTAGGAAGGAAGTATGGTC -3'
(R):5'- CTTGGAGAAGATCATGTTGCAAC -3'

Sequencing Primer
(F):5'- GGAAGGAAGTATGGTCATTGTATTAC -3'
(R):5'- GAAGATCATGTTGCAACCTAGTTATG -3'
Posted On2016-06-15