Mutagenetix > Incidental Mutation

Incidental Mutation 'R5122:Actr8'

393364

Institutional Source

Beutler Lab

Gene Symbol

Actr8

Ensembl Gene

ENSMUSG00000015971

Gene Name

ARP8 actin-related protein 8

Synonyms

5730542K05Rik, ARP8

MMRRC Submission

042710-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5122 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

29978337-30006354 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 29982715 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 57 (K57N)

Ref Sequence

ENSEMBL: ENSMUSP00000153459 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016115] [ENSMUST00000224797] [ENSMUST00000225811]

AlphaFold

Q8R2S9

Predicted Effect

probably benign
Transcript: ENSMUST00000016115
AA Change: K80N

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000016115
Gene: ENSMUSG00000015971
AA Change: K80N

Domain	Start	End	E-Value	Type
low complexity region	5	27	N/A	INTRINSIC
ACTIN	46	621	3.34e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224343

Predicted Effect

probably benign
Transcript: ENSMUST00000224797
AA Change: K80N

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225161

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225793

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225811
AA Change: K57N

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 37,034,757		probably null	Het
Acan	T	C	7: 79,100,661	S1727P	probably damaging	Het
Bcan	G	T	3: 87,994,207	S396Y	probably damaging	Het
Bmp2k	A	G	5: 97,087,015		probably benign	Het
Cd274	A	G	19: 29,380,565	H219R	possibly damaging	Het
Cdc16	A	T	8: 13,764,570	Y118F	probably damaging	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Chchd3	T	C	6: 32,968,305	R89G	probably benign	Het
Clstn2	C	T	9: 97,461,421	V658M	probably damaging	Het
Cpt1b	A	G	15: 89,424,023	S160P	probably benign	Het
Crym	T	C	7: 120,195,495	N167S	probably benign	Het
Dhx16	T	A	17: 35,883,310	Y438N	probably damaging	Het
Dnah12	A	G	14: 26,718,000	R536G	probably benign	Het
Dnajc11	A	G	4: 151,976,997	D382G	possibly damaging	Het
Dync1h1	G	A	12: 110,629,680	G1547D	probably damaging	Het
Eml3	T	A	19: 8,937,696		probably null	Het
Ep400	G	A	5: 110,668,170	P2799S	probably damaging	Het
Ephb6	T	C	6: 41,613,404	V30A	probably benign	Het
Fam53b	T	A	7: 132,779,262		probably benign	Het
Fcrl1	A	G	3: 87,385,774	K246R	probably benign	Het
Focad	G	A	4: 88,407,365		probably null	Het
Glipr1l2	T	C	10: 112,107,056	I272T	possibly damaging	Het
Gm597	A	G	1: 28,780,060	S47P	probably benign	Het
Gm8104	A	G	14: 43,109,093	I101V	probably benign	Het
Grm5	A	G	7: 88,074,820	I773V	probably damaging	Het
Hyal1	A	T	9: 107,578,069	T193S	probably benign	Het
Igkv10-94	C	A	6: 68,704,671	G62*	probably null	Het
Itsn1	A	G	16: 91,893,844		probably benign	Het
Kank4	A	G	4: 98,756,567	S983P	probably damaging	Het
Krtap16-1	C	A	11: 99,985,697	V294F	probably damaging	Het
Lama3	T	G	18: 12,539,766	V866G	possibly damaging	Het
Lrba	C	T	3: 86,349,154	R1268*	probably null	Het
Lrriq1	C	T	10: 103,187,453	V984I	probably damaging	Het
Macf1	A	C	4: 123,452,292	V4136G	probably damaging	Het
Mdn1	A	T	4: 32,670,593	E419D	probably damaging	Het
Nedd4l	A	G	18: 65,191,447	Y473C	probably damaging	Het
Nod2	G	T	8: 88,664,120	D330Y	probably damaging	Het
Nt5c2	C	T	19: 46,889,921	C458Y	probably damaging	Het
Numa1	T	C	7: 102,013,769	I681T	probably damaging	Het
Olfr713	C	A	7: 107,036,848	S231*	probably null	Het
Papolg	C	T	11: 23,867,501		probably null	Het
Parn	A	G	16: 13,654,447		probably null	Het
Pgap2	T	C	7: 102,231,391	F42S	probably damaging	Het
Phf11d	A	T	14: 59,353,344	M188K	possibly damaging	Het
Pofut2	G	C	10: 77,268,565	R392P	probably damaging	Het
Prpf18	T	C	2: 4,643,709	D102G	probably damaging	Het
Rreb1	T	A	13: 37,930,768	I701N	probably benign	Het
Slc26a5	T	C	5: 21,847,196	K45R	probably damaging	Het
Slc8a3	A	G	12: 81,314,258		probably null	Het
Slf1	T	A	13: 77,049,987	M723L	probably benign	Het
Sra1	T	C	18: 36,667,594	T187A	probably benign	Het
Stk17b	A	C	1: 53,776,558	N27K	probably damaging	Het
Tbc1d9	T	A	8: 83,236,543	Y295N	probably damaging	Het
Tubgcp6	A	G	15: 89,116,103	V353A	probably damaging	Het
Unc80	A	T	1: 66,679,590	T2991S	possibly damaging	Het
Urb1	G	A	16: 90,752,095	R2242*	probably null	Het
Vasp	T	C	7: 19,264,772	N20S	probably benign	Het
Zfp263	A	G	16: 3,749,855	H390R	probably damaging	Het

Other mutations in Actr8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Actr8	APN	14	29988335	missense	probably damaging	1.00
IGL01449:Actr8	APN	14	29990970	critical splice donor site	probably null
IGL01577:Actr8	APN	14	29987275	missense	probably benign
IGL02118:Actr8	APN	14	29982771	critical splice donor site	probably null
IGL02647:Actr8	APN	14	29990890	missense	probably damaging	1.00
IGL02659:Actr8	APN	14	29986341	missense	probably damaging	1.00
IGL02696:Actr8	APN	14	29982671	missense	probably benign	0.33
IGL03015:Actr8	APN	14	29986316	missense	possibly damaging	0.81
IGL03335:Actr8	APN	14	29978557	missense	probably benign
R0512:Actr8	UTSW	14	29978556	missense	probably benign	0.00
R0735:Actr8	UTSW	14	29989712	missense	probably benign	0.02
R0926:Actr8	UTSW	14	29987224	missense	probably benign	0.02
R1443:Actr8	UTSW	14	29984099	missense	possibly damaging	0.73
R1470:Actr8	UTSW	14	29986969	missense	possibly damaging	0.90
R1470:Actr8	UTSW	14	29986969	missense	possibly damaging	0.90
R1616:Actr8	UTSW	14	29982644	missense	possibly damaging	0.53
R2097:Actr8	UTSW	14	29987228	missense	probably damaging	0.98
R2240:Actr8	UTSW	14	29989757	missense	possibly damaging	0.94
R2570:Actr8	UTSW	14	29987282	missense	probably damaging	1.00
R5439:Actr8	UTSW	14	29986995	missense	probably damaging	1.00
R5697:Actr8	UTSW	14	29991673	missense	possibly damaging	0.73
R5727:Actr8	UTSW	14	29990881	missense	probably benign	0.01
R5860:Actr8	UTSW	14	29986285	nonsense	probably null
R5988:Actr8	UTSW	14	29993073	missense	possibly damaging	0.71
R6006:Actr8	UTSW	14	29984142	critical splice donor site	probably null
R6009:Actr8	UTSW	14	29978497	unclassified	probably benign
R6155:Actr8	UTSW	14	29978589	critical splice donor site	probably null
R6190:Actr8	UTSW	14	29991717	nonsense	probably null
R6329:Actr8	UTSW	14	29993084	nonsense	probably null
R6483:Actr8	UTSW	14	29978581	missense	possibly damaging	0.53
R6517:Actr8	UTSW	14	29982716	nonsense	probably null
R6562:Actr8	UTSW	14	29986454	splice site	probably null
R7484:Actr8	UTSW	14	29992968	missense	probably damaging	1.00
R8190:Actr8	UTSW	14	29984073	missense	possibly damaging	0.66
R8236:Actr8	UTSW	14	29982628	missense	probably damaging	1.00
R8516:Actr8	UTSW	14	29990899	missense	probably benign	0.17
R9484:Actr8	UTSW	14	29986344	missense	probably benign	0.19
Z1177:Actr8	UTSW	14	29986401	missense	probably damaging	1.00
Z1177:Actr8	UTSW	14	29987242	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATGATGTCCCTATGTTGGTCAC -3'
(R):5'- CCTGCAACCCTCAGTGATATTAC -3'

Sequencing Primer
(F):5'- ATGTTGGTCACCTATCACTGTC -3'
(R):5'- TTACAGTGAGCCACCATGTG -3'

Posted On

2016-06-15