Incidental Mutation 'R5122:Actr8'
ID 393364
Institutional Source Beutler Lab
Gene Symbol Actr8
Ensembl Gene ENSMUSG00000015971
Gene Name ARP8 actin-related protein 8
Synonyms 5730542K05Rik, ARP8
MMRRC Submission 042710-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5122 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 29978337-30006354 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 29982715 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 57 (K57N)
Ref Sequence ENSEMBL: ENSMUSP00000153459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016115] [ENSMUST00000224797] [ENSMUST00000225811]
AlphaFold Q8R2S9
Predicted Effect probably benign
Transcript: ENSMUST00000016115
AA Change: K80N

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000016115
Gene: ENSMUSG00000015971
AA Change: K80N

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
ACTIN 46 621 3.34e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224343
Predicted Effect probably benign
Transcript: ENSMUST00000224797
AA Change: K80N

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225793
Predicted Effect possibly damaging
Transcript: ENSMUST00000225811
AA Change: K57N

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,034,757 probably null Het
Acan T C 7: 79,100,661 S1727P probably damaging Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Bmp2k A G 5: 97,087,015 probably benign Het
Cd274 A G 19: 29,380,565 H219R possibly damaging Het
Cdc16 A T 8: 13,764,570 Y118F probably damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Chchd3 T C 6: 32,968,305 R89G probably benign Het
Clstn2 C T 9: 97,461,421 V658M probably damaging Het
Cpt1b A G 15: 89,424,023 S160P probably benign Het
Crym T C 7: 120,195,495 N167S probably benign Het
Dhx16 T A 17: 35,883,310 Y438N probably damaging Het
Dnah12 A G 14: 26,718,000 R536G probably benign Het
Dnajc11 A G 4: 151,976,997 D382G possibly damaging Het
Dync1h1 G A 12: 110,629,680 G1547D probably damaging Het
Eml3 T A 19: 8,937,696 probably null Het
Ep400 G A 5: 110,668,170 P2799S probably damaging Het
Ephb6 T C 6: 41,613,404 V30A probably benign Het
Fam53b T A 7: 132,779,262 probably benign Het
Fcrl1 A G 3: 87,385,774 K246R probably benign Het
Focad G A 4: 88,407,365 probably null Het
Glipr1l2 T C 10: 112,107,056 I272T possibly damaging Het
Gm597 A G 1: 28,780,060 S47P probably benign Het
Gm8104 A G 14: 43,109,093 I101V probably benign Het
Grm5 A G 7: 88,074,820 I773V probably damaging Het
Hyal1 A T 9: 107,578,069 T193S probably benign Het
Igkv10-94 C A 6: 68,704,671 G62* probably null Het
Itsn1 A G 16: 91,893,844 probably benign Het
Kank4 A G 4: 98,756,567 S983P probably damaging Het
Krtap16-1 C A 11: 99,985,697 V294F probably damaging Het
Lama3 T G 18: 12,539,766 V866G possibly damaging Het
Lrba C T 3: 86,349,154 R1268* probably null Het
Lrriq1 C T 10: 103,187,453 V984I probably damaging Het
Macf1 A C 4: 123,452,292 V4136G probably damaging Het
Mdn1 A T 4: 32,670,593 E419D probably damaging Het
Nedd4l A G 18: 65,191,447 Y473C probably damaging Het
Nod2 G T 8: 88,664,120 D330Y probably damaging Het
Nt5c2 C T 19: 46,889,921 C458Y probably damaging Het
Numa1 T C 7: 102,013,769 I681T probably damaging Het
Olfr713 C A 7: 107,036,848 S231* probably null Het
Papolg C T 11: 23,867,501 probably null Het
Parn A G 16: 13,654,447 probably null Het
Pgap2 T C 7: 102,231,391 F42S probably damaging Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Pofut2 G C 10: 77,268,565 R392P probably damaging Het
Prpf18 T C 2: 4,643,709 D102G probably damaging Het
Rreb1 T A 13: 37,930,768 I701N probably benign Het
Slc26a5 T C 5: 21,847,196 K45R probably damaging Het
Slc8a3 A G 12: 81,314,258 probably null Het
Slf1 T A 13: 77,049,987 M723L probably benign Het
Sra1 T C 18: 36,667,594 T187A probably benign Het
Stk17b A C 1: 53,776,558 N27K probably damaging Het
Tbc1d9 T A 8: 83,236,543 Y295N probably damaging Het
Tubgcp6 A G 15: 89,116,103 V353A probably damaging Het
Unc80 A T 1: 66,679,590 T2991S possibly damaging Het
Urb1 G A 16: 90,752,095 R2242* probably null Het
Vasp T C 7: 19,264,772 N20S probably benign Het
Zfp263 A G 16: 3,749,855 H390R probably damaging Het
Other mutations in Actr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Actr8 APN 14 29988335 missense probably damaging 1.00
IGL01449:Actr8 APN 14 29990970 critical splice donor site probably null
IGL01577:Actr8 APN 14 29987275 missense probably benign
IGL02118:Actr8 APN 14 29982771 critical splice donor site probably null
IGL02647:Actr8 APN 14 29990890 missense probably damaging 1.00
IGL02659:Actr8 APN 14 29986341 missense probably damaging 1.00
IGL02696:Actr8 APN 14 29982671 missense probably benign 0.33
IGL03015:Actr8 APN 14 29986316 missense possibly damaging 0.81
IGL03335:Actr8 APN 14 29978557 missense probably benign
R0512:Actr8 UTSW 14 29978556 missense probably benign 0.00
R0735:Actr8 UTSW 14 29989712 missense probably benign 0.02
R0926:Actr8 UTSW 14 29987224 missense probably benign 0.02
R1443:Actr8 UTSW 14 29984099 missense possibly damaging 0.73
R1470:Actr8 UTSW 14 29986969 missense possibly damaging 0.90
R1470:Actr8 UTSW 14 29986969 missense possibly damaging 0.90
R1616:Actr8 UTSW 14 29982644 missense possibly damaging 0.53
R2097:Actr8 UTSW 14 29987228 missense probably damaging 0.98
R2240:Actr8 UTSW 14 29989757 missense possibly damaging 0.94
R2570:Actr8 UTSW 14 29987282 missense probably damaging 1.00
R5439:Actr8 UTSW 14 29986995 missense probably damaging 1.00
R5697:Actr8 UTSW 14 29991673 missense possibly damaging 0.73
R5727:Actr8 UTSW 14 29990881 missense probably benign 0.01
R5860:Actr8 UTSW 14 29986285 nonsense probably null
R5988:Actr8 UTSW 14 29993073 missense possibly damaging 0.71
R6006:Actr8 UTSW 14 29984142 critical splice donor site probably null
R6009:Actr8 UTSW 14 29978497 unclassified probably benign
R6155:Actr8 UTSW 14 29978589 critical splice donor site probably null
R6190:Actr8 UTSW 14 29991717 nonsense probably null
R6329:Actr8 UTSW 14 29993084 nonsense probably null
R6483:Actr8 UTSW 14 29978581 missense possibly damaging 0.53
R6517:Actr8 UTSW 14 29982716 nonsense probably null
R6562:Actr8 UTSW 14 29986454 splice site probably null
R7484:Actr8 UTSW 14 29992968 missense probably damaging 1.00
R8190:Actr8 UTSW 14 29984073 missense possibly damaging 0.66
R8236:Actr8 UTSW 14 29982628 missense probably damaging 1.00
R8516:Actr8 UTSW 14 29990899 missense probably benign 0.17
R9484:Actr8 UTSW 14 29986344 missense probably benign 0.19
Z1177:Actr8 UTSW 14 29986401 missense probably damaging 1.00
Z1177:Actr8 UTSW 14 29987242 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGATGTCCCTATGTTGGTCAC -3'
(R):5'- CCTGCAACCCTCAGTGATATTAC -3'

Sequencing Primer
(F):5'- ATGTTGGTCACCTATCACTGTC -3'
(R):5'- TTACAGTGAGCCACCATGTG -3'
Posted On 2016-06-15