Incidental Mutation 'R5122:Dhx16'
ID393373
Institutional Source Beutler Lab
Gene Symbol Dhx16
Ensembl Gene ENSMUSG00000024422
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 16
SynonymsDdx16, DBP2, 2410006N22Rik
MMRRC Submission 042710-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5122 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35879819-35892670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35883310 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 438 (Y438N)
Ref Sequence ENSEMBL: ENSMUSP00000133888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025292] [ENSMUST00000174366]
Predicted Effect probably damaging
Transcript: ENSMUST00000025292
AA Change: Y438N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025292
Gene: ENSMUSG00000024422
AA Change: Y438N

DomainStartEndE-ValueType
Blast:DEXDc 55 310 6e-57 BLAST
DEXDc 400 585 7.26e-33 SMART
HELICc 636 733 1.7e-15 SMART
HA2 794 885 2.24e-31 SMART
Pfam:OB_NTP_bind 901 1018 3.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174330
Predicted Effect probably damaging
Transcript: ENSMUST00000174366
AA Change: Y438N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133888
Gene: ENSMUSG00000024422
AA Change: Y438N

DomainStartEndE-ValueType
Blast:DEXDc 55 310 9e-58 BLAST
DEXDc 400 585 7.26e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174449
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a functional homolog of fission yeast Prp8 protein involved in cell cycle progression. This gene is mapped to the MHC region on chromosome 6p21.3, a region where many malignant, genetic and autoimmune disease genes are linked. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,034,757 probably null Het
Acan T C 7: 79,100,661 S1727P probably damaging Het
Actr8 A T 14: 29,982,715 K57N possibly damaging Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Bmp2k A G 5: 97,087,015 probably benign Het
Cd274 A G 19: 29,380,565 H219R possibly damaging Het
Cdc16 A T 8: 13,764,570 Y118F probably damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Chchd3 T C 6: 32,968,305 R89G probably benign Het
Clstn2 C T 9: 97,461,421 V658M probably damaging Het
Cpt1b A G 15: 89,424,023 S160P probably benign Het
Crym T C 7: 120,195,495 N167S probably benign Het
Dnah12 A G 14: 26,718,000 R536G probably benign Het
Dnajc11 A G 4: 151,976,997 D382G possibly damaging Het
Dync1h1 G A 12: 110,629,680 G1547D probably damaging Het
Eml3 T A 19: 8,937,696 probably null Het
Ep400 G A 5: 110,668,170 P2799S probably damaging Het
Ephb6 T C 6: 41,613,404 V30A probably benign Het
Fam53b T A 7: 132,779,262 probably benign Het
Fcrl1 A G 3: 87,385,774 K246R probably benign Het
Focad G A 4: 88,407,365 probably null Het
Glipr1l2 T C 10: 112,107,056 I272T possibly damaging Het
Gm597 A G 1: 28,780,060 S47P probably benign Het
Gm8104 A G 14: 43,109,093 I101V probably benign Het
Grm5 A G 7: 88,074,820 I773V probably damaging Het
Hyal1 A T 9: 107,578,069 T193S probably benign Het
Igkv10-94 C A 6: 68,704,671 G62* probably null Het
Itsn1 A G 16: 91,893,844 probably benign Het
Kank4 A G 4: 98,756,567 S983P probably damaging Het
Krtap16-1 C A 11: 99,985,697 V294F probably damaging Het
Lama3 T G 18: 12,539,766 V866G possibly damaging Het
Lrba C T 3: 86,349,154 R1268* probably null Het
Lrriq1 C T 10: 103,187,453 V984I probably damaging Het
Macf1 A C 4: 123,452,292 V4136G probably damaging Het
Mdn1 A T 4: 32,670,593 E419D probably damaging Het
Nedd4l A G 18: 65,191,447 Y473C probably damaging Het
Nod2 G T 8: 88,664,120 D330Y probably damaging Het
Nt5c2 C T 19: 46,889,921 C458Y probably damaging Het
Numa1 T C 7: 102,013,769 I681T probably damaging Het
Olfr713 C A 7: 107,036,848 S231* probably null Het
Papolg C T 11: 23,867,501 probably null Het
Parn A G 16: 13,654,447 probably null Het
Pgap2 T C 7: 102,231,391 F42S probably damaging Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Pofut2 G C 10: 77,268,565 R392P probably damaging Het
Prpf18 T C 2: 4,643,709 D102G probably damaging Het
Rreb1 T A 13: 37,930,768 I701N probably benign Het
Slc26a5 T C 5: 21,847,196 K45R probably damaging Het
Slc8a3 A G 12: 81,314,258 probably null Het
Slf1 T A 13: 77,049,987 M723L probably benign Het
Sra1 T C 18: 36,667,594 T187A probably benign Het
Stk17b A C 1: 53,776,558 N27K probably damaging Het
Tbc1d9 T A 8: 83,236,543 Y295N probably damaging Het
Tubgcp6 A G 15: 89,116,103 V353A probably damaging Het
Unc80 A T 1: 66,679,590 T2991S possibly damaging Het
Urb1 G A 16: 90,752,095 R2242* probably null Het
Vasp T C 7: 19,264,772 N20S probably benign Het
Zfp263 A G 16: 3,749,855 H390R probably damaging Het
Other mutations in Dhx16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Dhx16 APN 17 35887934 missense probably benign 0.02
IGL01533:Dhx16 APN 17 35882047 missense probably damaging 1.00
IGL01743:Dhx16 APN 17 35888108 missense probably damaging 1.00
IGL01946:Dhx16 APN 17 35885504 missense probably benign 0.01
IGL02170:Dhx16 APN 17 35889469 missense probably damaging 1.00
IGL02327:Dhx16 APN 17 35883825 missense probably benign 0.00
IGL02334:Dhx16 APN 17 35884057 missense probably damaging 1.00
IGL02417:Dhx16 APN 17 35892537 missense probably damaging 1.00
R0403:Dhx16 UTSW 17 35883050 critical splice donor site probably null
R0410:Dhx16 UTSW 17 35890967 missense probably damaging 1.00
R0544:Dhx16 UTSW 17 35881659 missense probably benign 0.35
R0835:Dhx16 UTSW 17 35881689 missense probably damaging 1.00
R0845:Dhx16 UTSW 17 35883302 missense probably damaging 1.00
R1642:Dhx16 UTSW 17 35891065 missense probably damaging 1.00
R1833:Dhx16 UTSW 17 35885619 missense probably benign 0.36
R1905:Dhx16 UTSW 17 35888355 missense probably benign
R2233:Dhx16 UTSW 17 35887886 missense probably damaging 1.00
R2234:Dhx16 UTSW 17 35887886 missense probably damaging 1.00
R4647:Dhx16 UTSW 17 35885635 missense probably benign 0.10
R4648:Dhx16 UTSW 17 35885635 missense probably benign 0.10
R4665:Dhx16 UTSW 17 35879943 missense probably damaging 1.00
R4674:Dhx16 UTSW 17 35885939 missense probably damaging 1.00
R4862:Dhx16 UTSW 17 35883262 missense probably benign 0.34
R5089:Dhx16 UTSW 17 35884089 missense probably damaging 1.00
R5665:Dhx16 UTSW 17 35891086 nonsense probably null
R5748:Dhx16 UTSW 17 35883314 missense probably damaging 1.00
R5763:Dhx16 UTSW 17 35881688 missense possibly damaging 0.87
R5956:Dhx16 UTSW 17 35882870 missense probably damaging 0.96
R6001:Dhx16 UTSW 17 35883874 missense probably damaging 1.00
R6216:Dhx16 UTSW 17 35882972 missense possibly damaging 0.49
R6420:Dhx16 UTSW 17 35883014 missense possibly damaging 0.92
R6467:Dhx16 UTSW 17 35886184 missense probably damaging 1.00
R7326:Dhx16 UTSW 17 35886160 missense probably damaging 1.00
R7338:Dhx16 UTSW 17 35888144 missense probably damaging 1.00
R7457:Dhx16 UTSW 17 35891060 missense probably damaging 1.00
R7736:Dhx16 UTSW 17 35881676 missense possibly damaging 0.79
R8508:Dhx16 UTSW 17 35885920 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTCTGGGATGCTGACTC -3'
(R):5'- TCATGCAGGATGAAAGCCC -3'

Sequencing Primer
(F):5'- TGACTCGAGGGCCTCTAAAG -3'
(R):5'- CAAATCTATAATATCCATCTCCCTGC -3'
Posted On2016-06-15