Incidental Mutation 'R5122:Cd274'
ID393379
Institutional Source Beutler Lab
Gene Symbol Cd274
Ensembl Gene ENSMUSG00000016496
Gene NameCD274 antigen
SynonymsPdcd1lg1, B7-H1, PD-L1
MMRRC Submission 042710-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5122 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location29367455-29388095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29380565 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 219 (H219R)
Ref Sequence ENSEMBL: ENSMUSP00000016640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016640]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016640
AA Change: H219R

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000016640
Gene: ENSMUSG00000016496
AA Change: H219R

DomainStartEndE-ValueType
IG 24 131 1.5e-7 SMART
IG_like 138 226 4.78e1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is an immune inhibitory receptor ligand that is expressed by hematopoietic and non-hematopoietic cells, such as T cells and B cells and various types of tumor cells. The encoded protein is a type I transmembrane protein that has immunoglobulin V-like and C-like domains. Interaction of this ligand with its receptor inhibits T-cell activation and cytokine production. During infection or inflammation of normal tissue, this interaction is important for preventing autoimmunity by maintaining homeostasis of the immune response. In tumor microenvironments, this interaction provides an immune escape for tumor cells through cytotoxic T-cell inactivation. Mice deficient for this gene display a variety of phenotypes including decreased allogeneic fetal survival rates and severe experimental autoimmune encephalomyelitis. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered susceptibility to experimental autoimmune encephalomyelitis, induced arthritis, nerve injury, autoimmune diabetes, bacterial infection, viral infection, and parasitic infection due to abnormal T cellmorphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,034,757 probably null Het
Acan T C 7: 79,100,661 S1727P probably damaging Het
Actr8 A T 14: 29,982,715 K57N possibly damaging Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Bmp2k A G 5: 97,087,015 probably benign Het
Cdc16 A T 8: 13,764,570 Y118F probably damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Chchd3 T C 6: 32,968,305 R89G probably benign Het
Clstn2 C T 9: 97,461,421 V658M probably damaging Het
Cpt1b A G 15: 89,424,023 S160P probably benign Het
Crym T C 7: 120,195,495 N167S probably benign Het
Dhx16 T A 17: 35,883,310 Y438N probably damaging Het
Dnah12 A G 14: 26,718,000 R536G probably benign Het
Dnajc11 A G 4: 151,976,997 D382G possibly damaging Het
Dync1h1 G A 12: 110,629,680 G1547D probably damaging Het
Eml3 T A 19: 8,937,696 probably null Het
Ep400 G A 5: 110,668,170 P2799S probably damaging Het
Ephb6 T C 6: 41,613,404 V30A probably benign Het
Fam53b T A 7: 132,779,262 probably benign Het
Fcrl1 A G 3: 87,385,774 K246R probably benign Het
Focad G A 4: 88,407,365 probably null Het
Glipr1l2 T C 10: 112,107,056 I272T possibly damaging Het
Gm597 A G 1: 28,780,060 S47P probably benign Het
Gm8104 A G 14: 43,109,093 I101V probably benign Het
Grm5 A G 7: 88,074,820 I773V probably damaging Het
Hyal1 A T 9: 107,578,069 T193S probably benign Het
Igkv10-94 C A 6: 68,704,671 G62* probably null Het
Itsn1 A G 16: 91,893,844 probably benign Het
Kank4 A G 4: 98,756,567 S983P probably damaging Het
Krtap16-1 C A 11: 99,985,697 V294F probably damaging Het
Lama3 T G 18: 12,539,766 V866G possibly damaging Het
Lrba C T 3: 86,349,154 R1268* probably null Het
Lrriq1 C T 10: 103,187,453 V984I probably damaging Het
Macf1 A C 4: 123,452,292 V4136G probably damaging Het
Mdn1 A T 4: 32,670,593 E419D probably damaging Het
Nedd4l A G 18: 65,191,447 Y473C probably damaging Het
Nod2 G T 8: 88,664,120 D330Y probably damaging Het
Nt5c2 C T 19: 46,889,921 C458Y probably damaging Het
Numa1 T C 7: 102,013,769 I681T probably damaging Het
Olfr713 C A 7: 107,036,848 S231* probably null Het
Papolg C T 11: 23,867,501 probably null Het
Parn A G 16: 13,654,447 probably null Het
Pgap2 T C 7: 102,231,391 F42S probably damaging Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Pofut2 G C 10: 77,268,565 R392P probably damaging Het
Prpf18 T C 2: 4,643,709 D102G probably damaging Het
Rreb1 T A 13: 37,930,768 I701N probably benign Het
Slc26a5 T C 5: 21,847,196 K45R probably damaging Het
Slc8a3 A G 12: 81,314,258 probably null Het
Slf1 T A 13: 77,049,987 M723L probably benign Het
Sra1 T C 18: 36,667,594 T187A probably benign Het
Stk17b A C 1: 53,776,558 N27K probably damaging Het
Tbc1d9 T A 8: 83,236,543 Y295N probably damaging Het
Tubgcp6 A G 15: 89,116,103 V353A probably damaging Het
Unc80 A T 1: 66,679,590 T2991S possibly damaging Het
Urb1 G A 16: 90,752,095 R2242* probably null Het
Vasp T C 7: 19,264,772 N20S probably benign Het
Zfp263 A G 16: 3,749,855 H390R probably damaging Het
Other mutations in Cd274
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Cd274 APN 19 29385410 makesense probably null
IGL02232:Cd274 APN 19 29382538 missense probably damaging 0.99
IGL03304:Cd274 APN 19 29384102 missense probably damaging 0.99
R1233:Cd274 UTSW 19 29373901 critical splice donor site probably null
R1356:Cd274 UTSW 19 29373570 missense possibly damaging 0.92
R1464:Cd274 UTSW 19 29382592 splice site probably benign
R1853:Cd274 UTSW 19 29380482 missense probably damaging 1.00
R4280:Cd274 UTSW 19 29380471 missense probably benign
R4283:Cd274 UTSW 19 29380471 missense probably benign
R4553:Cd274 UTSW 19 29380448 missense probably benign 0.43
R5063:Cd274 UTSW 19 29384143 missense probably damaging 0.99
R5187:Cd274 UTSW 19 29382536 missense probably benign 0.01
R5736:Cd274 UTSW 19 29382540 missense probably benign 0.02
R6400:Cd274 UTSW 19 29385408 missense probably damaging 1.00
R8114:Cd274 UTSW 19 29384128 missense probably damaging 1.00
R8247:Cd274 UTSW 19 29385395 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGAAGCTGAGGTAATCTGG -3'
(R):5'- CTGTCTGTCAGGAGCAAACAC -3'

Sequencing Primer
(F):5'- GGTAATCTGGACAAACAGTGACCAC -3'
(R):5'- GACCAAGTAGCATTATGGCTTGCAC -3'
Posted On2016-06-15