Mutagenetix > Incidental Mutations

Incidental Mutation 'R5123:Col3a1'

393381

Institutional Source

Beutler Lab

Gene Symbol

Col3a1

Ensembl Gene

ENSMUSG00000026043

Gene Name

collagen, type III, alpha 1

Synonyms

Col3a-1

MMRRC Submission

042711-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.709) question?

Stock #

R5123 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45311538-45349706 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to A at 45333596 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087883]

Predicted Effect

unknown
Transcript: ENSMUST00000087883
AA Change: A514T

SMART Domains

Protein: ENSMUSP00000085192
Gene: ENSMUSG00000026043
AA Change: A514T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
VWC	33	89	2.73e-20	SMART
low complexity region	100	140	N/A	INTRINSIC
low complexity region	163	227	N/A	INTRINSIC
low complexity region	230	248	N/A	INTRINSIC
internal_repeat_2	249	284	3.45e-13	PROSPERO
internal_repeat_1	250	290	1.9e-17	PROSPERO
Pfam:Collagen	293	366	7.3e-9	PFAM
low complexity region	368	419	N/A	INTRINSIC
internal_repeat_4	423	476	2.52e-11	PROSPERO
internal_repeat_1	427	488	1.9e-17	PROSPERO
internal_repeat_3	427	491	7.39e-12	PROSPERO
internal_repeat_2	456	491	3.45e-13	PROSPERO
Pfam:Collagen	533	592	2.6e-11	PFAM
low complexity region	632	680	N/A	INTRINSIC
low complexity region	683	776	N/A	INTRINSIC
low complexity region	784	815	N/A	INTRINSIC
low complexity region	818	855	N/A	INTRINSIC
low complexity region	865	921	N/A	INTRINSIC
low complexity region	925	950	N/A	INTRINSIC
low complexity region	953	974	N/A	INTRINSIC
internal_repeat_4	975	1028	2.52e-11	PROSPERO
internal_repeat_3	976	1029	7.39e-12	PROSPERO
internal_repeat_5	977	991	3.33e-5	PROSPERO
internal_repeat_5	1019	1033	3.33e-5	PROSPERO
low complexity region	1037	1058	N/A	INTRINSIC
Pfam:Collagen	1076	1135	5.6e-13	PFAM
Pfam:Collagen	1136	1209	4.3e-11	PFAM
COLFI	1229	1464	5.73e-166	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123204

Predicted Effect

probably benign
Transcript: ENSMUST00000185687

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190943

Meta Mutation Damage Score

0.0867

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type III collagen found in bone, cartilage, dentin, tendon, bone marrow stroma and other connective tissue. The encoded protein forms homotrimeric type III procollagen that undergoes proteolytic processing during fibril formation. A majority of mice lacking the encoded protein die within two days of birth but about 5% of the animals survive to adulthood. The surviving mice exhibit severe cortical malformation and experience significantly shorter lifespan. The mutant mouse named "tight skin 2" exhibiting systemic sclerosis phenotype was found to harbor a missense point mutation in this gene. A pseudogene of this gene has been defined on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Most homozygous mutants die within 48 hours after birth. Surviving mutants have reduced body size, skin lesions, enlarged intestines, and die by 6 months of age from ruptured blood vessels. Occasionally intestinal rupture also results in early death. Heterozygotes exhibit tight skin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	G	A	17: 24,384,460	G542D	possibly damaging	Het
Adh6b	A	G	3: 138,357,689	Y343C	probably damaging	Het
Adsl	T	A	15: 80,952,294		probably null	Het
Apob	T	A	12: 8,007,630		probably null	Het
Atp6ap1l	T	A	13: 90,898,898		probably benign	Het
Cacnb3	A	G	15: 98,639,869	D74G	probably damaging	Het
Clca3a2	T	A	3: 144,806,343	D544V	probably damaging	Het
D7Ertd443e	A	G	7: 134,349,668		probably null	Het
Dscam	T	C	16: 96,772,437	D775G	probably damaging	Het
Eif2b3	T	A	4: 117,022,211	M16K	probably damaging	Het
Eml5	T	C	12: 98,874,512	Y281C	probably damaging	Het
Epha2	T	A	4: 141,308,865	L204Q	possibly damaging	Het
Filip1l	A	C	16: 57,570,662	I538L	possibly damaging	Het
Gcnt2	T	A	13: 40,918,355	V158D	probably damaging	Het
Gnaq	A	G	19: 16,332,085	N162S	probably benign	Het
Haus5	A	T	7: 30,654,226	N575K	probably benign	Het
Hjurp	A	T	1: 88,275,050	Y71N	possibly damaging	Het
Igsf5	A	G	16: 96,373,079	D103G	probably damaging	Het
Myo10	A	G	15: 25,726,483	D297G	possibly damaging	Het
Net1	C	T	13: 3,886,623	R314H	probably damaging	Het
Olfr1273-ps	C	A	2: 90,296,168	R231L	probably benign	Het
Olfr1301	T	A	2: 111,754,552	V101D	probably damaging	Het
Pcsk4	C	A	10: 80,322,145	Q586H	probably null	Het
Pramef6	A	T	4: 143,897,136	M156K	probably benign	Het
Prss1	A	G	6: 41,463,197	D156G	possibly damaging	Het
Rnf133	A	T	6: 23,649,260	N266K	probably damaging	Het
Setd2	G	T	9: 110,617,527	A2482S	possibly damaging	Het
Sgo2a	A	T	1: 58,016,567	S637C	probably damaging	Het
Slc2a5	C	A	4: 150,139,805	S290*	probably null	Het
Spata6	T	G	4: 111,768,795	H120Q	possibly damaging	Het
Stk11	G	A	10: 80,127,941	V194I	probably damaging	Het
Tkt	T	C	14: 30,565,646	V199A	probably benign	Het
Traf3	G	A	12: 111,243,518	V183M	possibly damaging	Het
Trappc11	T	C	8: 47,513,402	Y483C	probably damaging	Het
Trappc9	T	C	15: 72,913,366		probably benign	Het
Trim59	T	C	3: 69,037,734	H91R	probably benign	Het
Ttc21a	A	G	9: 119,952,212	S484G	probably benign	Het
Usp13	A	T	3: 32,915,798	H691L	probably benign	Het
Vmn1r238	T	C	18: 3,123,243	Y57C	probably benign	Het
Vmn2r111	T	A	17: 22,571,143	Q294L	possibly damaging	Het
Vmn2r17	A	G	5: 109,427,908	D215G	possibly damaging	Het
Wdr66	A	G	5: 123,273,633		probably benign	Het
Zfp280b	A	G	10: 76,039,349	D354G	probably benign	Het
Zfp607a	A	G	7: 27,879,098	H531R	probably damaging	Het
Zfp74	A	T	7: 29,934,733	C517S	probably damaging	Het

Other mutations in Col3a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Col3a1	APN	1	45347135	missense	probably damaging	1.00
IGL00928:Col3a1	APN	1	45340858	intron	probably benign
IGL00958:Col3a1	APN	1	45327595	missense	unknown
IGL01353:Col3a1	APN	1	45333638	unclassified	probably benign
IGL01820:Col3a1	APN	1	45321608	missense	unknown
IGL01839:Col3a1	APN	1	45311830	missense	unknown
IGL02517:Col3a1	APN	1	45325803	critical splice acceptor site	probably null
IGL02879:Col3a1	APN	1	45340959	intron	probably benign
IGL02960:Col3a1	APN	1	45328455	missense	unknown
IGL03245:Col3a1	APN	1	45331109	unclassified	probably benign
IGL03308:Col3a1	APN	1	45330617	splice site	probably benign
Kraken	UTSW	1	45327866	splice site	probably null
IGL03050:Col3a1	UTSW	1	45328925	splice site	probably null
PIT4520001:Col3a1	UTSW	1	45335783	critical splice donor site	probably null
R0063:Col3a1	UTSW	1	45330541	splice site	probably benign
R0122:Col3a1	UTSW	1	45340897	intron	probably benign
R0131:Col3a1	UTSW	1	45328868	splice site	probably benign
R0762:Col3a1	UTSW	1	45321526	missense	unknown
R0765:Col3a1	UTSW	1	45336651	unclassified	probably benign
R0853:Col3a1	UTSW	1	45343324	intron	probably benign
R0898:Col3a1	UTSW	1	45333993	unclassified	probably benign
R1170:Col3a1	UTSW	1	45327601	missense	unknown
R1170:Col3a1	UTSW	1	45347724	missense	probably damaging	1.00
R1440:Col3a1	UTSW	1	45343312	splice site	probably null
R1449:Col3a1	UTSW	1	45321611	missense	unknown
R1526:Col3a1	UTSW	1	45321688	missense	unknown
R1572:Col3a1	UTSW	1	45345968	missense	possibly damaging	0.95
R1585:Col3a1	UTSW	1	45327866	splice site	probably null
R1616:Col3a1	UTSW	1	45328488	critical splice donor site	probably null
R1691:Col3a1	UTSW	1	45348616	unclassified	probably benign
R1876:Col3a1	UTSW	1	45342235	splice site	probably null
R1937:Col3a1	UTSW	1	45334293	unclassified	probably benign
R2093:Col3a1	UTSW	1	45332990	missense	probably damaging	1.00
R2110:Col3a1	UTSW	1	45330145	missense	unknown
R2119:Col3a1	UTSW	1	45346121	missense	probably damaging	1.00
R2256:Col3a1	UTSW	1	45321632	missense	unknown
R2327:Col3a1	UTSW	1	45338611	unclassified	probably benign
R2518:Col3a1	UTSW	1	45337512	unclassified	probably benign
R2991:Col3a1	UTSW	1	45335779	unclassified	probably benign
R3405:Col3a1	UTSW	1	45338753	unclassified	probably benign
R3784:Col3a1	UTSW	1	45347135	missense	probably damaging	1.00
R3847:Col3a1	UTSW	1	45321990	missense	unknown
R3848:Col3a1	UTSW	1	45321990	missense	unknown
R3849:Col3a1	UTSW	1	45321990	missense	unknown
R4502:Col3a1	UTSW	1	45348677	unclassified	probably benign
R4503:Col3a1	UTSW	1	45348677	unclassified	probably benign
R4764:Col3a1	UTSW	1	45346110	missense	probably damaging	1.00
R4839:Col3a1	UTSW	1	45323803	splice site	probably null
R4934:Col3a1	UTSW	1	45339952	unclassified	probably benign
R5033:Col3a1	UTSW	1	45346110	missense	probably damaging	1.00
R5190:Col3a1	UTSW	1	45329084	missense	unknown
R5190:Col3a1	UTSW	1	45344807	intron	probably benign
R5375:Col3a1	UTSW	1	45347899	unclassified	probably null
R5407:Col3a1	UTSW	1	45346052	missense	probably benign	0.03
R5627:Col3a1	UTSW	1	45331560	unclassified	probably benign
R5642:Col3a1	UTSW	1	45331712	unclassified	probably benign
R6014:Col3a1	UTSW	1	45321579	nonsense	probably null
R6052:Col3a1	UTSW	1	45345013	unclassified	probably benign
R6263:Col3a1	UTSW	1	45321575	missense	unknown
R6453:Col3a1	UTSW	1	45339378	unclassified	probably benign
R6463:Col3a1	UTSW	1	45342205	intron	probably benign
R6488:Col3a1	UTSW	1	45331534	unclassified	probably benign
R6525:Col3a1	UTSW	1	45347179	missense	possibly damaging	0.88
R6637:Col3a1	UTSW	1	45347730	missense	probably damaging	1.00
R6704:Col3a1	UTSW	1	45347732	missense	probably damaging	1.00
R6744:Col3a1	UTSW	1	45338622	unclassified	probably benign
R6745:Col3a1	UTSW	1	45338622	unclassified	probably benign
R6747:Col3a1	UTSW	1	45338622	unclassified	probably benign
R6858:Col3a1	UTSW	1	45345984	missense	probably damaging	1.00
R6903:Col3a1	UTSW	1	45331988	missense	probably damaging	0.96
R7189:Col3a1	UTSW	1	45333657	missense	unknown
R7194:Col3a1	UTSW	1	45331700	missense	unknown
R7199:Col3a1	UTSW	1	45332141	missense	probably null	0.99
R7204:Col3a1	UTSW	1	45322418	missense	unknown
R7304:Col3a1	UTSW	1	45347811	missense	unknown
R7378:Col3a1	UTSW	1	45327647	splice site	probably null
R7398:Col3a1	UTSW	1	45327813	missense	unknown
R7742:Col3a1	UTSW	1	45345001	missense	unknown
R8072:Col3a1	UTSW	1	45321574	missense	unknown
Z1177:Col3a1	UTSW	1	45311800	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GCATGGAAAATTCATCATAGTTGCCC -3'
(R):5'- TATGTATCCTTGCAAATGTACTCCC -3'

Sequencing Primer
(F):5'- GTTGCCCAATTTTTCTTCAAGATG -3'
(R):5'- AATCTGTCTTGACCCATGGTTG -3'

Posted On

2016-06-15