Incidental Mutation 'R5123:Sgo2a'
ID393382
Institutional Source Beutler Lab
Gene Symbol Sgo2a
Ensembl Gene ENSMUSG00000026039
Gene Nameshugoshin 2A
SynonymsSgol2a, Sgol2, 1110007N04Rik, D1Ertd8e, 5730576N04Rik, Tripin
MMRRC Submission 042711-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5123 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location57995971-58025899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58016567 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 637 (S637C)
Ref Sequence ENSEMBL: ENSMUSP00000027202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027202] [ENSMUST00000163061]
Predicted Effect probably damaging
Transcript: ENSMUST00000027202
AA Change: S637C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027202
Gene: ENSMUSG00000026039
AA Change: S637C

DomainStartEndE-ValueType
coiled coil region 54 109 N/A INTRINSIC
low complexity region 182 198 N/A INTRINSIC
low complexity region 371 381 N/A INTRINSIC
low complexity region 396 431 N/A INTRINSIC
low complexity region 583 597 N/A INTRINSIC
low complexity region 718 729 N/A INTRINSIC
low complexity region 1068 1078 N/A INTRINSIC
low complexity region 1112 1125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163061
SMART Domains Protein: ENSMUSP00000124053
Gene: ENSMUSG00000054770

DomainStartEndE-ValueType
BTB 23 123 1.01e-2 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (53/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with abnormalities in meiosis but not in mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,384,460 G542D possibly damaging Het
Adh6b A G 3: 138,357,689 Y343C probably damaging Het
Adsl T A 15: 80,952,294 probably null Het
Apob T A 12: 8,007,630 probably null Het
Atp6ap1l T A 13: 90,898,898 probably benign Het
Cacnb3 A G 15: 98,639,869 D74G probably damaging Het
Clca3a2 T A 3: 144,806,343 D544V probably damaging Het
Col3a1 G A 1: 45,333,596 probably benign Het
D7Ertd443e A G 7: 134,349,668 probably null Het
Dscam T C 16: 96,772,437 D775G probably damaging Het
Eif2b3 T A 4: 117,022,211 M16K probably damaging Het
Eml5 T C 12: 98,874,512 Y281C probably damaging Het
Epha2 T A 4: 141,308,865 L204Q possibly damaging Het
Filip1l A C 16: 57,570,662 I538L possibly damaging Het
Gcnt2 T A 13: 40,918,355 V158D probably damaging Het
Gnaq A G 19: 16,332,085 N162S probably benign Het
Haus5 A T 7: 30,654,226 N575K probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Igsf5 A G 16: 96,373,079 D103G probably damaging Het
Myo10 A G 15: 25,726,483 D297G possibly damaging Het
Net1 C T 13: 3,886,623 R314H probably damaging Het
Olfr1273-ps C A 2: 90,296,168 R231L probably benign Het
Olfr1301 T A 2: 111,754,552 V101D probably damaging Het
Pcsk4 C A 10: 80,322,145 Q586H probably null Het
Pramef6 A T 4: 143,897,136 M156K probably benign Het
Prss1 A G 6: 41,463,197 D156G possibly damaging Het
Rnf133 A T 6: 23,649,260 N266K probably damaging Het
Setd2 G T 9: 110,617,527 A2482S possibly damaging Het
Slc2a5 C A 4: 150,139,805 S290* probably null Het
Spata6 T G 4: 111,768,795 H120Q possibly damaging Het
Stk11 G A 10: 80,127,941 V194I probably damaging Het
Tkt T C 14: 30,565,646 V199A probably benign Het
Traf3 G A 12: 111,243,518 V183M possibly damaging Het
Trappc11 T C 8: 47,513,402 Y483C probably damaging Het
Trappc9 T C 15: 72,913,366 probably benign Het
Trim59 T C 3: 69,037,734 H91R probably benign Het
Ttc21a A G 9: 119,952,212 S484G probably benign Het
Usp13 A T 3: 32,915,798 H691L probably benign Het
Vmn1r238 T C 18: 3,123,243 Y57C probably benign Het
Vmn2r111 T A 17: 22,571,143 Q294L possibly damaging Het
Vmn2r17 A G 5: 109,427,908 D215G possibly damaging Het
Wdr66 A G 5: 123,273,633 probably benign Het
Zfp280b A G 10: 76,039,349 D354G probably benign Het
Zfp607a A G 7: 27,879,098 H531R probably damaging Het
Zfp74 A T 7: 29,934,733 C517S probably damaging Het
Other mutations in Sgo2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Sgo2a APN 1 58016594 missense probably damaging 1.00
IGL00534:Sgo2a APN 1 58016344 missense probably damaging 1.00
IGL00902:Sgo2a APN 1 58016099 missense probably benign 0.00
IGL01571:Sgo2a APN 1 58017974 missense probably damaging 0.99
IGL02268:Sgo2a APN 1 58017722 missense probably benign 0.10
IGL02756:Sgo2a APN 1 58016350 missense probably damaging 1.00
IGL02887:Sgo2a APN 1 58016352 missense probably damaging 0.99
IGL02991:Sgo2a APN 1 58015355 intron probably benign
harpo UTSW 1 58019660 nonsense probably null
mashugana UTSW 1 58016567 missense probably damaging 1.00
meshugas UTSW 1 58002933 nonsense probably null
R0036:Sgo2a UTSW 1 58015628 missense probably benign 0.14
R0036:Sgo2a UTSW 1 58015628 missense probably benign 0.14
R0095:Sgo2a UTSW 1 58015555 missense probably benign 0.11
R0325:Sgo2a UTSW 1 58016697 missense probably benign
R0464:Sgo2a UTSW 1 58000094 missense probably damaging 0.98
R0699:Sgo2a UTSW 1 57998149 nonsense probably null
R1251:Sgo2a UTSW 1 57999962 critical splice acceptor site probably null
R1355:Sgo2a UTSW 1 58017965 missense possibly damaging 0.91
R1457:Sgo2a UTSW 1 58015806 missense probably benign 0.00
R2244:Sgo2a UTSW 1 58017054 missense probably benign 0.00
R3896:Sgo2a UTSW 1 58013646 missense probably damaging 0.99
R4919:Sgo2a UTSW 1 57998134 missense probably damaging 0.99
R5030:Sgo2a UTSW 1 58017759 nonsense probably null
R5317:Sgo2a UTSW 1 58015524 missense probably benign
R5767:Sgo2a UTSW 1 58019660 nonsense probably null
R5844:Sgo2a UTSW 1 58016397 missense probably damaging 0.99
R6018:Sgo2a UTSW 1 58016959 missense probably benign 0.01
R6039:Sgo2a UTSW 1 58016616 missense possibly damaging 0.78
R6039:Sgo2a UTSW 1 58016616 missense possibly damaging 0.78
R6450:Sgo2a UTSW 1 58002933 nonsense probably null
R6998:Sgo2a UTSW 1 58016640 missense probably damaging 0.99
R7073:Sgo2a UTSW 1 58017785 missense possibly damaging 0.73
R7508:Sgo2a UTSW 1 58017795 missense probably benign 0.11
R7722:Sgo2a UTSW 1 58016537 missense probably benign 0.45
X0065:Sgo2a UTSW 1 58016358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTCAGTGCTCAACAAAATC -3'
(R):5'- GAGCAATGAACACCTTGGTC -3'

Sequencing Primer
(F):5'- GCCAAGTATATGAGGACAATG -3'
(R):5'- TGAACACCTTGGTCATTACTAAAAC -3'
Posted On2016-06-15