Incidental Mutation 'R5123:Olfr1301'
ID393384
Institutional Source Beutler Lab
Gene Symbol Olfr1301
Ensembl Gene ENSMUSG00000057149
Gene Nameolfactory receptor 1301
SynonymsGA_x6K02T2Q125-72805651-72806589, MOR248-5
MMRRC Submission 042711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R5123 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111751006-111758852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111754552 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 101 (V101D)
Ref Sequence ENSEMBL: ENSMUSP00000146530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080094] [ENSMUST00000207590]
Predicted Effect probably damaging
Transcript: ENSMUST00000080094
AA Change: V101D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000078993
Gene: ENSMUSG00000057149
AA Change: V101D

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.1e-53 PFAM
Pfam:7tm_1 41 287 2.2e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207590
AA Change: V101D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,384,460 G542D possibly damaging Het
Adh6b A G 3: 138,357,689 Y343C probably damaging Het
Adsl T A 15: 80,952,294 probably null Het
Apob T A 12: 8,007,630 probably null Het
Atp6ap1l T A 13: 90,898,898 probably benign Het
Cacnb3 A G 15: 98,639,869 D74G probably damaging Het
Clca3a2 T A 3: 144,806,343 D544V probably damaging Het
Col3a1 G A 1: 45,333,596 probably benign Het
D7Ertd443e A G 7: 134,349,668 probably null Het
Dscam T C 16: 96,772,437 D775G probably damaging Het
Eif2b3 T A 4: 117,022,211 M16K probably damaging Het
Eml5 T C 12: 98,874,512 Y281C probably damaging Het
Epha2 T A 4: 141,308,865 L204Q possibly damaging Het
Filip1l A C 16: 57,570,662 I538L possibly damaging Het
Gcnt2 T A 13: 40,918,355 V158D probably damaging Het
Gnaq A G 19: 16,332,085 N162S probably benign Het
Haus5 A T 7: 30,654,226 N575K probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Igsf5 A G 16: 96,373,079 D103G probably damaging Het
Myo10 A G 15: 25,726,483 D297G possibly damaging Het
Net1 C T 13: 3,886,623 R314H probably damaging Het
Olfr1273-ps C A 2: 90,296,168 R231L probably benign Het
Pcsk4 C A 10: 80,322,145 Q586H probably null Het
Pramef6 A T 4: 143,897,136 M156K probably benign Het
Prss1 A G 6: 41,463,197 D156G possibly damaging Het
Rnf133 A T 6: 23,649,260 N266K probably damaging Het
Setd2 G T 9: 110,617,527 A2482S possibly damaging Het
Sgo2a A T 1: 58,016,567 S637C probably damaging Het
Slc2a5 C A 4: 150,139,805 S290* probably null Het
Spata6 T G 4: 111,768,795 H120Q possibly damaging Het
Stk11 G A 10: 80,127,941 V194I probably damaging Het
Tkt T C 14: 30,565,646 V199A probably benign Het
Traf3 G A 12: 111,243,518 V183M possibly damaging Het
Trappc11 T C 8: 47,513,402 Y483C probably damaging Het
Trappc9 T C 15: 72,913,366 probably benign Het
Trim59 T C 3: 69,037,734 H91R probably benign Het
Ttc21a A G 9: 119,952,212 S484G probably benign Het
Usp13 A T 3: 32,915,798 H691L probably benign Het
Vmn1r238 T C 18: 3,123,243 Y57C probably benign Het
Vmn2r111 T A 17: 22,571,143 Q294L possibly damaging Het
Vmn2r17 A G 5: 109,427,908 D215G possibly damaging Het
Wdr66 A G 5: 123,273,633 probably benign Het
Zfp280b A G 10: 76,039,349 D354G probably benign Het
Zfp607a A G 7: 27,879,098 H531R probably damaging Het
Zfp74 A T 7: 29,934,733 C517S probably damaging Het
Other mutations in Olfr1301
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Olfr1301 APN 2 111754426 missense probably damaging 1.00
IGL01396:Olfr1301 APN 2 111754603 missense probably damaging 1.00
IGL01396:Olfr1301 APN 2 111754503 missense probably benign 0.01
IGL01538:Olfr1301 APN 2 111755005 missense probably damaging 0.98
IGL01795:Olfr1301 APN 2 111754386 missense probably benign 0.00
IGL02007:Olfr1301 APN 2 111754479 missense probably damaging 0.99
IGL02738:Olfr1301 APN 2 111754354 missense probably damaging 1.00
IGL03365:Olfr1301 APN 2 111754427 missense possibly damaging 0.95
R0014:Olfr1301 UTSW 2 111754774 missense probably damaging 1.00
R0115:Olfr1301 UTSW 2 111754585 missense probably damaging 1.00
R0481:Olfr1301 UTSW 2 111754585 missense probably damaging 1.00
R1441:Olfr1301 UTSW 2 111755002 missense probably damaging 1.00
R1583:Olfr1301 UTSW 2 111754425 missense probably damaging 0.98
R2091:Olfr1301 UTSW 2 111754386 missense probably benign 0.00
R2301:Olfr1301 UTSW 2 111754276 missense probably benign 0.01
R2363:Olfr1301 UTSW 2 111754794 missense probably damaging 0.97
R2511:Olfr1301 UTSW 2 111754316 missense probably benign 0.00
R3686:Olfr1301 UTSW 2 111754569 missense probably benign 0.00
R4841:Olfr1301 UTSW 2 111754334 missense probably benign 0.00
R4915:Olfr1301 UTSW 2 111754380 missense probably benign 0.00
R4961:Olfr1301 UTSW 2 111754405 missense probably damaging 1.00
R5417:Olfr1301 UTSW 2 111754920 missense possibly damaging 0.50
R5654:Olfr1301 UTSW 2 111754981 missense probably damaging 1.00
R5753:Olfr1301 UTSW 2 111754801 missense possibly damaging 0.51
R6361:Olfr1301 UTSW 2 111754595 missense probably damaging 1.00
R6525:Olfr1301 UTSW 2 111754984 missense probably benign 0.09
R6682:Olfr1301 UTSW 2 111754635 missense probably damaging 1.00
R7099:Olfr1301 UTSW 2 111755076 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGCTCACAGAATCTTCAGGTC -3'
(R):5'- ATGGCATGCACAAAGGCAATTG -3'

Sequencing Primer
(F):5'- GCTCACAGAATCTTCAGGTCTTACTC -3'
(R):5'- GCAATTGCCCAGGAAGTTAAC -3'
Posted On2016-06-15