Incidental Mutation 'R5123:Usp13'
ID393385
Institutional Source Beutler Lab
Gene Symbol Usp13
Ensembl Gene ENSMUSG00000056900
Gene Nameubiquitin specific peptidase 13 (isopeptidase T-3)
SynonymsISOT3, 2700071E21Rik, IsoT-3
MMRRC Submission 042711-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5123 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location32817546-32938071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32915798 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 691 (H691L)
Ref Sequence ENSEMBL: ENSMUSP00000072155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072312] [ENSMUST00000108228] [ENSMUST00000172481]
Predicted Effect probably benign
Transcript: ENSMUST00000072312
AA Change: H691L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000072155
Gene: ENSMUSG00000056900
AA Change: H691L

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Blast:ZnF_UBP 46 91 1e-17 BLAST
low complexity region 116 134 N/A INTRINSIC
ZnF_UBP 208 263 2.91e-20 SMART
low complexity region 625 639 N/A INTRINSIC
UBA 652 690 1.25e-6 SMART
UBA 724 761 1.19e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108228
AA Change: H690L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103863
Gene: ENSMUSG00000056900
AA Change: H690L

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Blast:ZnF_UBP 46 91 1e-17 BLAST
low complexity region 115 133 N/A INTRINSIC
ZnF_UBP 207 262 2.91e-20 SMART
low complexity region 624 638 N/A INTRINSIC
UBA 651 689 1.25e-6 SMART
UBA 723 760 1.19e-12 SMART
Predicted Effect unknown
Transcript: ENSMUST00000156769
AA Change: H47L
SMART Domains Protein: ENSMUSP00000117605
Gene: ENSMUSG00000056900
AA Change: H47L

DomainStartEndE-ValueType
UBA 9 47 1.25e-6 SMART
UBA 81 118 1.19e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172481
SMART Domains Protein: ENSMUSP00000133823
Gene: ENSMUSG00000056900

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Blast:ZnF_UBP 46 91 9e-18 BLAST
low complexity region 116 134 N/A INTRINSIC
ZnF_UBP 208 263 2.91e-20 SMART
Pfam:UCH 333 523 5.1e-27 PFAM
Meta Mutation Damage Score 0.7979 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,384,460 G542D possibly damaging Het
Adh6b A G 3: 138,357,689 Y343C probably damaging Het
Adsl T A 15: 80,952,294 probably null Het
Apob T A 12: 8,007,630 probably null Het
Atp6ap1l T A 13: 90,898,898 probably benign Het
Cacnb3 A G 15: 98,639,869 D74G probably damaging Het
Clca3a2 T A 3: 144,806,343 D544V probably damaging Het
Col3a1 G A 1: 45,333,596 probably benign Het
D7Ertd443e A G 7: 134,349,668 probably null Het
Dscam T C 16: 96,772,437 D775G probably damaging Het
Eif2b3 T A 4: 117,022,211 M16K probably damaging Het
Eml5 T C 12: 98,874,512 Y281C probably damaging Het
Epha2 T A 4: 141,308,865 L204Q possibly damaging Het
Filip1l A C 16: 57,570,662 I538L possibly damaging Het
Gcnt2 T A 13: 40,918,355 V158D probably damaging Het
Gnaq A G 19: 16,332,085 N162S probably benign Het
Haus5 A T 7: 30,654,226 N575K probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Igsf5 A G 16: 96,373,079 D103G probably damaging Het
Myo10 A G 15: 25,726,483 D297G possibly damaging Het
Net1 C T 13: 3,886,623 R314H probably damaging Het
Olfr1273-ps C A 2: 90,296,168 R231L probably benign Het
Olfr1301 T A 2: 111,754,552 V101D probably damaging Het
Pcsk4 C A 10: 80,322,145 Q586H probably null Het
Pramef6 A T 4: 143,897,136 M156K probably benign Het
Prss1 A G 6: 41,463,197 D156G possibly damaging Het
Rnf133 A T 6: 23,649,260 N266K probably damaging Het
Setd2 G T 9: 110,617,527 A2482S possibly damaging Het
Sgo2a A T 1: 58,016,567 S637C probably damaging Het
Slc2a5 C A 4: 150,139,805 S290* probably null Het
Spata6 T G 4: 111,768,795 H120Q possibly damaging Het
Stk11 G A 10: 80,127,941 V194I probably damaging Het
Tkt T C 14: 30,565,646 V199A probably benign Het
Traf3 G A 12: 111,243,518 V183M possibly damaging Het
Trappc11 T C 8: 47,513,402 Y483C probably damaging Het
Trappc9 T C 15: 72,913,366 probably benign Het
Trim59 T C 3: 69,037,734 H91R probably benign Het
Ttc21a A G 9: 119,952,212 S484G probably benign Het
Vmn1r238 T C 18: 3,123,243 Y57C probably benign Het
Vmn2r111 T A 17: 22,571,143 Q294L possibly damaging Het
Vmn2r17 A G 5: 109,427,908 D215G possibly damaging Het
Wdr66 A G 5: 123,273,633 probably benign Het
Zfp280b A G 10: 76,039,349 D354G probably benign Het
Zfp607a A G 7: 27,879,098 H531R probably damaging Het
Zfp74 A T 7: 29,934,733 C517S probably damaging Het
Other mutations in Usp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Usp13 APN 3 32881411 missense probably damaging 0.98
IGL00949:Usp13 APN 3 32886577 missense possibly damaging 0.57
IGL01637:Usp13 APN 3 32919064 missense probably benign 0.02
IGL01983:Usp13 APN 3 32917459 missense probably damaging 1.00
IGL02002:Usp13 APN 3 32847825 missense probably damaging 0.97
IGL02065:Usp13 APN 3 32933165 missense probably damaging 1.00
IGL02390:Usp13 APN 3 32931716 nonsense probably null
IGL02399:Usp13 APN 3 32919060 missense probably damaging 1.00
IGL02535:Usp13 APN 3 32837926 missense probably benign 0.43
IGL02863:Usp13 APN 3 32918947 missense possibly damaging 0.95
IGL03017:Usp13 APN 3 32915712 missense possibly damaging 0.90
IGL03242:Usp13 APN 3 32902069 missense probably benign 0.17
PIT4504001:Usp13 UTSW 3 32905430 missense probably damaging 1.00
R0113:Usp13 UTSW 3 32817876 splice site probably benign
R0233:Usp13 UTSW 3 32915664 splice site probably null
R0233:Usp13 UTSW 3 32915664 splice site probably null
R1241:Usp13 UTSW 3 32915708 missense probably damaging 1.00
R1765:Usp13 UTSW 3 32915770 missense probably benign 0.01
R2105:Usp13 UTSW 3 32901986 missense probably damaging 0.97
R2229:Usp13 UTSW 3 32917551 missense probably benign 0.02
R2381:Usp13 UTSW 3 32881509 critical splice donor site probably null
R2389:Usp13 UTSW 3 32905464 missense probably benign 0.16
R3801:Usp13 UTSW 3 32881508 missense possibly damaging 0.75
R4062:Usp13 UTSW 3 32881423 missense probably damaging 1.00
R4653:Usp13 UTSW 3 32837924 missense probably damaging 0.99
R5454:Usp13 UTSW 3 32905436 missense probably damaging 1.00
R5527:Usp13 UTSW 3 32865838 missense probably damaging 1.00
R5582:Usp13 UTSW 3 32911589 missense probably damaging 1.00
R5589:Usp13 UTSW 3 32837858 missense probably damaging 1.00
R5829:Usp13 UTSW 3 32886523 missense possibly damaging 0.68
R6114:Usp13 UTSW 3 32854669 missense probably damaging 1.00
R6625:Usp13 UTSW 3 32894876 missense probably damaging 0.98
R6680:Usp13 UTSW 3 32881469 missense probably damaging 0.98
R7175:Usp13 UTSW 3 32917608 nonsense probably null
R7232:Usp13 UTSW 3 32865871 missense probably benign 0.05
R7242:Usp13 UTSW 3 32865743 splice site probably null
R7263:Usp13 UTSW 3 32894851 missense probably damaging 1.00
R7533:Usp13 UTSW 3 32918942 missense probably damaging 0.99
R7716:Usp13 UTSW 3 32837856 nonsense probably null
R7734:Usp13 UTSW 3 32837905 missense probably benign 0.13
R7943:Usp13 UTSW 3 32876940 missense probably damaging 1.00
R8075:Usp13 UTSW 3 32931703 missense probably damaging 1.00
R8141:Usp13 UTSW 3 32894876 missense possibly damaging 0.52
R8259:Usp13 UTSW 3 32917599 nonsense probably null
X0064:Usp13 UTSW 3 32886589 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGTCTCTGAGGGGTTGAAG -3'
(R):5'- CACACCGCATCCTTCTAATGTG -3'

Sequencing Primer
(F):5'- AAGAAGTGCACAGTTGGGTTTCTC -3'
(R):5'- GGTAGGCAAACTGTGTACTCC -3'
Posted On2016-06-15