Incidental Mutation 'R5123:Trim59'
ID393386
Institutional Source Beutler Lab
Gene Symbol Trim59
Ensembl Gene ENSMUSG00000034317
Gene Nametripartite motif-containing 59
SynonymsMrf1, 2310035M22Rik, 2700022F13Rik, TSBF1
MMRRC Submission 042711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5123 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location69035288-69044755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69037734 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 91 (H91R)
Ref Sequence ENSEMBL: ENSMUSP00000120270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042901] [ENSMUST00000107802] [ENSMUST00000107803] [ENSMUST00000136512] [ENSMUST00000148385]
Predicted Effect probably benign
Transcript: ENSMUST00000042901
SMART Domains Protein: ENSMUSP00000047872
Gene: ENSMUSG00000034349

DomainStartEndE-ValueType
PDB:1W1W|D 89 238 1e-17 PDB
Blast:AAA 104 238 3e-6 BLAST
low complexity region 408 427 N/A INTRINSIC
low complexity region 447 460 N/A INTRINSIC
low complexity region 473 482 N/A INTRINSIC
low complexity region 545 567 N/A INTRINSIC
SMC_hinge 611 726 1.12e-31 SMART
low complexity region 870 881 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
Blast:AAA 1102 1276 5e-26 BLAST
PDB:3KTA|D 1125 1276 3e-30 PDB
SCOP:d1e69a_ 1188 1263 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107802
AA Change: H91R

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103432
Gene: ENSMUSG00000034317
AA Change: H91R

DomainStartEndE-ValueType
RING 10 59 2.44e-8 SMART
Pfam:zf-B_box 92 134 5.9e-10 PFAM
transmembrane domain 329 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107803
SMART Domains Protein: ENSMUSP00000103433
Gene: ENSMUSG00000034349

DomainStartEndE-ValueType
Pfam:AAA_23 59 329 1.3e-12 PFAM
Pfam:AAA_21 81 199 5.2e-7 PFAM
coiled coil region 369 482 N/A INTRINSIC
coiled coil region 511 563 N/A INTRINSIC
SMC_hinge 586 701 8.6e-36 SMART
Pfam:SMC_N 738 1247 1.1e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128118
Predicted Effect probably benign
Transcript: ENSMUST00000136512
AA Change: H91R

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120270
Gene: ENSMUSG00000034317
AA Change: H91R

DomainStartEndE-ValueType
RING 10 59 2.44e-8 SMART
Pfam:zf-B_box 92 134 8.4e-10 PFAM
transmembrane domain 329 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148385
Meta Mutation Damage Score 0.1237 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,384,460 G542D possibly damaging Het
Adh6b A G 3: 138,357,689 Y343C probably damaging Het
Adsl T A 15: 80,952,294 probably null Het
Apob T A 12: 8,007,630 probably null Het
Atp6ap1l T A 13: 90,898,898 probably benign Het
Cacnb3 A G 15: 98,639,869 D74G probably damaging Het
Clca3a2 T A 3: 144,806,343 D544V probably damaging Het
Col3a1 G A 1: 45,333,596 probably benign Het
D7Ertd443e A G 7: 134,349,668 probably null Het
Dscam T C 16: 96,772,437 D775G probably damaging Het
Eif2b3 T A 4: 117,022,211 M16K probably damaging Het
Eml5 T C 12: 98,874,512 Y281C probably damaging Het
Epha2 T A 4: 141,308,865 L204Q possibly damaging Het
Filip1l A C 16: 57,570,662 I538L possibly damaging Het
Gcnt2 T A 13: 40,918,355 V158D probably damaging Het
Gnaq A G 19: 16,332,085 N162S probably benign Het
Haus5 A T 7: 30,654,226 N575K probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Igsf5 A G 16: 96,373,079 D103G probably damaging Het
Myo10 A G 15: 25,726,483 D297G possibly damaging Het
Net1 C T 13: 3,886,623 R314H probably damaging Het
Olfr1273-ps C A 2: 90,296,168 R231L probably benign Het
Olfr1301 T A 2: 111,754,552 V101D probably damaging Het
Pcsk4 C A 10: 80,322,145 Q586H probably null Het
Pramef6 A T 4: 143,897,136 M156K probably benign Het
Prss1 A G 6: 41,463,197 D156G possibly damaging Het
Rnf133 A T 6: 23,649,260 N266K probably damaging Het
Setd2 G T 9: 110,617,527 A2482S possibly damaging Het
Sgo2a A T 1: 58,016,567 S637C probably damaging Het
Slc2a5 C A 4: 150,139,805 S290* probably null Het
Spata6 T G 4: 111,768,795 H120Q possibly damaging Het
Stk11 G A 10: 80,127,941 V194I probably damaging Het
Tkt T C 14: 30,565,646 V199A probably benign Het
Traf3 G A 12: 111,243,518 V183M possibly damaging Het
Trappc11 T C 8: 47,513,402 Y483C probably damaging Het
Trappc9 T C 15: 72,913,366 probably benign Het
Ttc21a A G 9: 119,952,212 S484G probably benign Het
Usp13 A T 3: 32,915,798 H691L probably benign Het
Vmn1r238 T C 18: 3,123,243 Y57C probably benign Het
Vmn2r111 T A 17: 22,571,143 Q294L possibly damaging Het
Vmn2r17 A G 5: 109,427,908 D215G possibly damaging Het
Wdr66 A G 5: 123,273,633 probably benign Het
Zfp280b A G 10: 76,039,349 D354G probably benign Het
Zfp607a A G 7: 27,879,098 H531R probably damaging Het
Zfp74 A T 7: 29,934,733 C517S probably damaging Het
Other mutations in Trim59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Trim59 APN 3 69037379 missense probably benign 0.00
IGL02172:Trim59 APN 3 69037477 missense probably benign 0.00
IGL03051:Trim59 APN 3 69036873 missense probably benign 0.00
R0865:Trim59 UTSW 3 69037608 missense probably damaging 1.00
R1729:Trim59 UTSW 3 69036853 missense probably benign 0.03
R1839:Trim59 UTSW 3 69037638 missense probably damaging 1.00
R2212:Trim59 UTSW 3 69037543 missense probably benign 0.31
R2311:Trim59 UTSW 3 69037829 nonsense probably null
R3766:Trim59 UTSW 3 69036804 missense probably benign
R4633:Trim59 UTSW 3 69037414 missense probably benign 0.16
R4823:Trim59 UTSW 3 69037120 missense probably benign 0.13
R7125:Trim59 UTSW 3 69036864 missense probably benign 0.04
R7633:Trim59 UTSW 3 69037926 missense probably damaging 1.00
R7892:Trim59 UTSW 3 69037807 missense probably benign
R7975:Trim59 UTSW 3 69037807 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCTTTTCAATAAGGCGAGTG -3'
(R):5'- GGAAAATGTTCTTCAGGCATCTG -3'

Sequencing Primer
(F):5'- CAATAAGGCGAGTGATATCTGTCC -3'
(R):5'- CTGGTAACTTTTACATATGGAGGCC -3'
Posted On2016-06-15