Incidental Mutation 'R5123:Spata6'
ID393389
Institutional Source Beutler Lab
Gene Symbol Spata6
Ensembl Gene ENSMUSG00000034401
Gene Namespermatogenesis associated 6
Synonyms1700062C23Rik, Hash, KRP
MMRRC Submission 042711-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5123 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location111719984-111829184 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 111768795 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 120 (H120Q)
Ref Sequence ENSEMBL: ENSMUSP00000114610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038868] [ENSMUST00000070513] [ENSMUST00000084354] [ENSMUST00000153746]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038868
AA Change: H120Q

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036964
Gene: ENSMUSG00000034401
AA Change: H120Q

DomainStartEndE-ValueType
Pfam:SPATA6 11 149 3.4e-56 PFAM
low complexity region 182 198 N/A INTRINSIC
low complexity region 397 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070513
SMART Domains Protein: ENSMUSP00000069435
Gene: ENSMUSG00000034401

DomainStartEndE-ValueType
Pfam:SPATA6 10 93 5.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084354
AA Change: H120Q

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000081383
Gene: ENSMUSG00000034401
AA Change: H120Q

DomainStartEndE-ValueType
Pfam:SPATA6 10 149 1.9e-57 PFAM
low complexity region 182 198 N/A INTRINSIC
low complexity region 377 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140366
Predicted Effect possibly damaging
Transcript: ENSMUST00000153746
AA Change: H120Q

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114610
Gene: ENSMUSG00000034401
AA Change: H120Q

DomainStartEndE-ValueType
Pfam:SPATA6 10 149 3e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156179
Meta Mutation Damage Score 0.0844 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (53/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit abnormal formation of the sperm connecting piece during late spermiogenesis, leading to acephalic spermatozoa and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,384,460 G542D possibly damaging Het
Adh6b A G 3: 138,357,689 Y343C probably damaging Het
Adsl T A 15: 80,952,294 probably null Het
Apob T A 12: 8,007,630 probably null Het
Atp6ap1l T A 13: 90,898,898 probably benign Het
Cacnb3 A G 15: 98,639,869 D74G probably damaging Het
Clca3a2 T A 3: 144,806,343 D544V probably damaging Het
Col3a1 G A 1: 45,333,596 probably benign Het
D7Ertd443e A G 7: 134,349,668 probably null Het
Dscam T C 16: 96,772,437 D775G probably damaging Het
Eif2b3 T A 4: 117,022,211 M16K probably damaging Het
Eml5 T C 12: 98,874,512 Y281C probably damaging Het
Epha2 T A 4: 141,308,865 L204Q possibly damaging Het
Filip1l A C 16: 57,570,662 I538L possibly damaging Het
Gcnt2 T A 13: 40,918,355 V158D probably damaging Het
Gnaq A G 19: 16,332,085 N162S probably benign Het
Haus5 A T 7: 30,654,226 N575K probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Igsf5 A G 16: 96,373,079 D103G probably damaging Het
Myo10 A G 15: 25,726,483 D297G possibly damaging Het
Net1 C T 13: 3,886,623 R314H probably damaging Het
Olfr1273-ps C A 2: 90,296,168 R231L probably benign Het
Olfr1301 T A 2: 111,754,552 V101D probably damaging Het
Pcsk4 C A 10: 80,322,145 Q586H probably null Het
Pramef6 A T 4: 143,897,136 M156K probably benign Het
Prss1 A G 6: 41,463,197 D156G possibly damaging Het
Rnf133 A T 6: 23,649,260 N266K probably damaging Het
Setd2 G T 9: 110,617,527 A2482S possibly damaging Het
Sgo2a A T 1: 58,016,567 S637C probably damaging Het
Slc2a5 C A 4: 150,139,805 S290* probably null Het
Stk11 G A 10: 80,127,941 V194I probably damaging Het
Tkt T C 14: 30,565,646 V199A probably benign Het
Traf3 G A 12: 111,243,518 V183M possibly damaging Het
Trappc11 T C 8: 47,513,402 Y483C probably damaging Het
Trappc9 T C 15: 72,913,366 probably benign Het
Trim59 T C 3: 69,037,734 H91R probably benign Het
Ttc21a A G 9: 119,952,212 S484G probably benign Het
Usp13 A T 3: 32,915,798 H691L probably benign Het
Vmn1r238 T C 18: 3,123,243 Y57C probably benign Het
Vmn2r111 T A 17: 22,571,143 Q294L possibly damaging Het
Vmn2r17 A G 5: 109,427,908 D215G possibly damaging Het
Wdr66 A G 5: 123,273,633 probably benign Het
Zfp280b A G 10: 76,039,349 D354G probably benign Het
Zfp607a A G 7: 27,879,098 H531R probably damaging Het
Zfp74 A T 7: 29,934,733 C517S probably damaging Het
Other mutations in Spata6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Spata6 APN 4 111805928 splice site probably benign
IGL02110:Spata6 APN 4 111784806 missense possibly damaging 0.53
IGL03181:Spata6 APN 4 111822766 missense probably benign 0.11
PIT4378001:Spata6 UTSW 4 111746181 missense possibly damaging 0.71
R0043:Spata6 UTSW 4 111780805 missense probably damaging 0.98
R1199:Spata6 UTSW 4 111799145 missense possibly damaging 0.53
R1491:Spata6 UTSW 4 111746191 missense probably damaging 0.99
R1548:Spata6 UTSW 4 111779006 missense probably benign 0.18
R1582:Spata6 UTSW 4 111780795 nonsense probably null
R1582:Spata6 UTSW 4 111780797 missense probably benign 0.00
R4690:Spata6 UTSW 4 111774826 missense probably damaging 1.00
R5360:Spata6 UTSW 4 111822829 missense possibly damaging 0.96
R5373:Spata6 UTSW 4 111822834 critical splice donor site probably null
R5396:Spata6 UTSW 4 111799118 missense probably damaging 1.00
R5919:Spata6 UTSW 4 111779208 missense probably damaging 0.96
R6017:Spata6 UTSW 4 111774827 missense probably damaging 1.00
R6476:Spata6 UTSW 4 111774823 missense probably damaging 1.00
R6573:Spata6 UTSW 4 111779279 missense probably damaging 1.00
R6807:Spata6 UTSW 4 111784815 missense probably benign 0.01
R7341:Spata6 UTSW 4 111768738 nonsense probably null
R7406:Spata6 UTSW 4 111780820 missense possibly damaging 0.70
R8116:Spata6 UTSW 4 111828320 missense possibly damaging 0.96
RF002:Spata6 UTSW 4 111828305 missense probably benign
X0066:Spata6 UTSW 4 111828304 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATACAATAAGGCATCAGGC -3'
(R):5'- ATCAGCCAATAGGAGTTGTGTTAG -3'

Sequencing Primer
(F):5'- AGTGGGAGAAACACTGTC -3'
(R):5'- AGCCAATAGGAGTTGTGTTAGTTTGG -3'
Posted On2016-06-15