Mutagenetix > Incidental Mutations

Incidental Mutation 'R5123:Eif2b3'

393390

Institutional Source

Beutler Lab

Gene Symbol

Eif2b3

Ensembl Gene

ENSMUSG00000028683

Gene Name

eukaryotic translation initiation factor 2B, subunit 3

Synonyms

1190002P15Rik

MMRRC Submission

042711-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5123 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

117019402-117087306 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 117022211 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 16 (M16K)

Ref Sequence

ENSEMBL: ENSMUSP00000102056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070610] [ENSMUST00000106447] [ENSMUST00000106448]

Predicted Effect

probably damaging
Transcript: ENSMUST00000070610
AA Change: M16K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000070334
Gene: ENSMUSG00000028683
AA Change: M16K

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	4	139	8.2e-20	PFAM
Pfam:NTP_transf_3	5	226	8.5e-19	PFAM
low complexity region	247	262	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106447
AA Change: M16K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102055
Gene: ENSMUSG00000028683
AA Change: M16K

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	4	139	1.1e-19	PFAM
Pfam:NTP_transf_3	5	221	1.7e-18	PFAM
low complexity region	247	262	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106448
AA Change: M16K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102056
Gene: ENSMUSG00000028683
AA Change: M16K

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	4	140	3.2e-19	PFAM
Pfam:NTP_transf_3	5	237	3.7e-18	PFAM
low complexity region	247	262	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157724

Meta Mutation Damage Score

0.9734

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the subunits of initiation factor eIF2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. It has also been found to function as a cofactor of hepatitis C virus internal ribosome entry site-mediated translation. Mutations in this gene have been associated with leukodystrophy with vanishing white matter. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	G	A	17: 24,384,460	G542D	possibly damaging	Het
Adh6b	A	G	3: 138,357,689	Y343C	probably damaging	Het
Adsl	T	A	15: 80,952,294		probably null	Het
Apob	T	A	12: 8,007,630		probably null	Het
Atp6ap1l	T	A	13: 90,898,898		probably benign	Het
Cacnb3	A	G	15: 98,639,869	D74G	probably damaging	Het
Clca3a2	T	A	3: 144,806,343	D544V	probably damaging	Het
Col3a1	G	A	1: 45,333,596		probably benign	Het
D7Ertd443e	A	G	7: 134,349,668		probably null	Het
Dscam	T	C	16: 96,772,437	D775G	probably damaging	Het
Eml5	T	C	12: 98,874,512	Y281C	probably damaging	Het
Epha2	T	A	4: 141,308,865	L204Q	possibly damaging	Het
Filip1l	A	C	16: 57,570,662	I538L	possibly damaging	Het
Gcnt2	T	A	13: 40,918,355	V158D	probably damaging	Het
Gnaq	A	G	19: 16,332,085	N162S	probably benign	Het
Haus5	A	T	7: 30,654,226	N575K	probably benign	Het
Hjurp	A	T	1: 88,275,050	Y71N	possibly damaging	Het
Igsf5	A	G	16: 96,373,079	D103G	probably damaging	Het
Myo10	A	G	15: 25,726,483	D297G	possibly damaging	Het
Net1	C	T	13: 3,886,623	R314H	probably damaging	Het
Olfr1273-ps	C	A	2: 90,296,168	R231L	probably benign	Het
Olfr1301	T	A	2: 111,754,552	V101D	probably damaging	Het
Pcsk4	C	A	10: 80,322,145	Q586H	probably null	Het
Pramef6	A	T	4: 143,897,136	M156K	probably benign	Het
Prss1	A	G	6: 41,463,197	D156G	possibly damaging	Het
Rnf133	A	T	6: 23,649,260	N266K	probably damaging	Het
Setd2	G	T	9: 110,617,527	A2482S	possibly damaging	Het
Sgo2a	A	T	1: 58,016,567	S637C	probably damaging	Het
Slc2a5	C	A	4: 150,139,805	S290*	probably null	Het
Spata6	T	G	4: 111,768,795	H120Q	possibly damaging	Het
Stk11	G	A	10: 80,127,941	V194I	probably damaging	Het
Tkt	T	C	14: 30,565,646	V199A	probably benign	Het
Traf3	G	A	12: 111,243,518	V183M	possibly damaging	Het
Trappc11	T	C	8: 47,513,402	Y483C	probably damaging	Het
Trappc9	T	C	15: 72,913,366		probably benign	Het
Trim59	T	C	3: 69,037,734	H91R	probably benign	Het
Ttc21a	A	G	9: 119,952,212	S484G	probably benign	Het
Usp13	A	T	3: 32,915,798	H691L	probably benign	Het
Vmn1r238	T	C	18: 3,123,243	Y57C	probably benign	Het
Vmn2r111	T	A	17: 22,571,143	Q294L	possibly damaging	Het
Vmn2r17	A	G	5: 109,427,908	D215G	possibly damaging	Het
Wdr66	A	G	5: 123,273,633		probably benign	Het
Zfp280b	A	G	10: 76,039,349	D354G	probably benign	Het
Zfp607a	A	G	7: 27,879,098	H531R	probably damaging	Het
Zfp74	A	T	7: 29,934,733	C517S	probably damaging	Het

Other mutations in Eif2b3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Eif2b3	APN	4	117066469	missense	probably benign
IGL01333:Eif2b3	APN	4	117070690	missense	probably benign	0.31
IGL01564:Eif2b3	APN	4	117028542	missense	probably benign	0.00
IGL01721:Eif2b3	APN	4	117058804	missense	probably damaging	1.00
IGL02061:Eif2b3	APN	4	117028411	missense	possibly damaging	0.78
R0835:Eif2b3	UTSW	4	117058805	missense	probably damaging	1.00
R0924:Eif2b3	UTSW	4	117081578	missense	possibly damaging	0.93
R2167:Eif2b3	UTSW	4	117028540	missense	probably damaging	1.00
R2424:Eif2b3	UTSW	4	117070848	missense	probably benign	0.01
R3902:Eif2b3	UTSW	4	117022207	missense	probably damaging	1.00
R4105:Eif2b3	UTSW	4	117081634	missense	probably damaging	1.00
R4688:Eif2b3	UTSW	4	117058849	missense	probably benign	0.03
R4998:Eif2b3	UTSW	4	117066392	missense	probably benign	0.06
R5033:Eif2b3	UTSW	4	117052736	missense	probably damaging	1.00
R5493:Eif2b3	UTSW	4	117086722	missense	possibly damaging	0.92
R5787:Eif2b3	UTSW	4	117044440	missense	probably damaging	1.00
R5789:Eif2b3	UTSW	4	117028495	missense	probably damaging	1.00
R6347:Eif2b3	UTSW	4	117044566	missense	probably benign	0.05
R6361:Eif2b3	UTSW	4	117028425	missense	possibly damaging	0.66
R6643:Eif2b3	UTSW	4	117070757	missense	probably damaging	0.97
R6798:Eif2b3	UTSW	4	117066458	missense	probably benign	0.00
R7299:Eif2b3	UTSW	4	117052822	missense	probably benign	0.27
R7301:Eif2b3	UTSW	4	117052822	missense	probably benign	0.27
R7451:Eif2b3	UTSW	4	117052796	nonsense	probably null
R7934:Eif2b3	UTSW	4	117066478	missense	probably benign
R8117:Eif2b3	UTSW	4	117022217	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGGAGTGTTTCTTACTCTGGTAAC -3'
(R):5'- GCAAGCTTTAAGCCCTAGCC -3'

Sequencing Primer
(F):5'- CTCTGGTAACTAAATCAGAAGTGGC -3'
(R):5'- AAGCTTTAAGCCCTAGCCTGCTATG -3'

Posted On

2016-06-15