Incidental Mutation 'R5123:Slc2a5'
ID393393
Institutional Source Beutler Lab
Gene Symbol Slc2a5
Ensembl Gene ENSMUSG00000028976
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 5
SynonymsGLUT5
MMRRC Submission 042711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5123 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location150119283-150144169 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 150139805 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 290 (S290*)
Ref Sequence ENSEMBL: ENSMUSP00000030826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030826]
Predicted Effect probably null
Transcript: ENSMUST00000030826
AA Change: S290*
SMART Domains Protein: ENSMUSP00000030826
Gene: ENSMUSG00000028976
AA Change: S290*

DomainStartEndE-ValueType
Pfam:MFS_1 16 397 1e-19 PFAM
Pfam:Sugar_tr 19 474 2.1e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151504
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a fructose transporter responsible for fructose uptake by the small intestine. The encoded protein also is necessary for the increase in blood pressure due to high dietary fructose consumption. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal cochlear morphology and physiology with no detectable alterations in outer hair cell morphology, electromotility or nonlinear capacitance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,384,460 G542D possibly damaging Het
Adh6b A G 3: 138,357,689 Y343C probably damaging Het
Adsl T A 15: 80,952,294 probably null Het
Apob T A 12: 8,007,630 probably null Het
Atp6ap1l T A 13: 90,898,898 probably benign Het
Cacnb3 A G 15: 98,639,869 D74G probably damaging Het
Clca3a2 T A 3: 144,806,343 D544V probably damaging Het
Col3a1 G A 1: 45,333,596 probably benign Het
D7Ertd443e A G 7: 134,349,668 probably null Het
Dscam T C 16: 96,772,437 D775G probably damaging Het
Eif2b3 T A 4: 117,022,211 M16K probably damaging Het
Eml5 T C 12: 98,874,512 Y281C probably damaging Het
Epha2 T A 4: 141,308,865 L204Q possibly damaging Het
Filip1l A C 16: 57,570,662 I538L possibly damaging Het
Gcnt2 T A 13: 40,918,355 V158D probably damaging Het
Gnaq A G 19: 16,332,085 N162S probably benign Het
Haus5 A T 7: 30,654,226 N575K probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Igsf5 A G 16: 96,373,079 D103G probably damaging Het
Myo10 A G 15: 25,726,483 D297G possibly damaging Het
Net1 C T 13: 3,886,623 R314H probably damaging Het
Olfr1273-ps C A 2: 90,296,168 R231L probably benign Het
Olfr1301 T A 2: 111,754,552 V101D probably damaging Het
Pcsk4 C A 10: 80,322,145 Q586H probably null Het
Pramef6 A T 4: 143,897,136 M156K probably benign Het
Prss1 A G 6: 41,463,197 D156G possibly damaging Het
Rnf133 A T 6: 23,649,260 N266K probably damaging Het
Setd2 G T 9: 110,617,527 A2482S possibly damaging Het
Sgo2a A T 1: 58,016,567 S637C probably damaging Het
Spata6 T G 4: 111,768,795 H120Q possibly damaging Het
Stk11 G A 10: 80,127,941 V194I probably damaging Het
Tkt T C 14: 30,565,646 V199A probably benign Het
Traf3 G A 12: 111,243,518 V183M possibly damaging Het
Trappc11 T C 8: 47,513,402 Y483C probably damaging Het
Trappc9 T C 15: 72,913,366 probably benign Het
Trim59 T C 3: 69,037,734 H91R probably benign Het
Ttc21a A G 9: 119,952,212 S484G probably benign Het
Usp13 A T 3: 32,915,798 H691L probably benign Het
Vmn1r238 T C 18: 3,123,243 Y57C probably benign Het
Vmn2r111 T A 17: 22,571,143 Q294L possibly damaging Het
Vmn2r17 A G 5: 109,427,908 D215G possibly damaging Het
Wdr66 A G 5: 123,273,633 probably benign Het
Zfp280b A G 10: 76,039,349 D354G probably benign Het
Zfp607a A G 7: 27,879,098 H531R probably damaging Het
Zfp74 A T 7: 29,934,733 C517S probably damaging Het
Other mutations in Slc2a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Slc2a5 APN 4 150125656 missense probably damaging 1.00
IGL01071:Slc2a5 APN 4 150120733 utr 5 prime probably benign
IGL01977:Slc2a5 APN 4 150142218 missense probably damaging 0.97
IGL03271:Slc2a5 APN 4 150135583 missense probably damaging 1.00
BB006:Slc2a5 UTSW 4 150139485 missense probably benign 0.39
BB016:Slc2a5 UTSW 4 150139485 missense probably benign 0.39
R0760:Slc2a5 UTSW 4 150139667 missense probably benign
R0906:Slc2a5 UTSW 4 150142830 missense probably benign 0.21
R1099:Slc2a5 UTSW 4 150142179 missense probably benign 0.01
R1809:Slc2a5 UTSW 4 150143057 missense probably damaging 1.00
R2099:Slc2a5 UTSW 4 150143177 nonsense probably null
R2152:Slc2a5 UTSW 4 150125638 missense probably damaging 1.00
R2253:Slc2a5 UTSW 4 150139990 missense possibly damaging 0.78
R2696:Slc2a5 UTSW 4 150120746 missense probably benign
R4835:Slc2a5 UTSW 4 150140005 missense probably benign 0.06
R4926:Slc2a5 UTSW 4 150120742 nonsense probably null
R5397:Slc2a5 UTSW 4 150139823 splice site probably null
R6209:Slc2a5 UTSW 4 150143100 missense probably benign 0.00
R6342:Slc2a5 UTSW 4 150139526 missense possibly damaging 0.93
R6547:Slc2a5 UTSW 4 150135619 missense possibly damaging 0.94
R7340:Slc2a5 UTSW 4 150139982 missense probably benign 0.44
R7507:Slc2a5 UTSW 4 150125650 missense probably damaging 1.00
R7537:Slc2a5 UTSW 4 150129069 missense possibly damaging 0.89
R7572:Slc2a5 UTSW 4 150142185 missense probably benign 0.33
R7751:Slc2a5 UTSW 4 150143134 missense probably damaging 1.00
R7929:Slc2a5 UTSW 4 150139485 missense probably benign 0.39
R8058:Slc2a5 UTSW 4 150143133 missense probably damaging 1.00
R8318:Slc2a5 UTSW 4 150139658 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCTACCTGCTGATCCAGAAG -3'
(R):5'- TGTCACATACTGGACGTCGTC -3'

Sequencing Primer
(F):5'- GGAGCTCTTCGCCTCTGAG -3'
(R):5'- GGACGTCGTCGCTTTTCACG -3'
Posted On2016-06-15