Mutagenetix > Incidental Mutations

Incidental Mutation 'R5123:Vmn2r17'

393394

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r17

Ensembl Gene

ENSMUSG00000091879

Gene Name

vomeronasal 2, receptor 17

Synonyms

EG384221

MMRRC Submission

042711-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R5123 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109420013-109453387 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 109427908 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 215 (D215G)

Ref Sequence

ENSEMBL: ENSMUSP00000131450 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171841]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171841
AA Change: D215G

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000131450
Gene: ENSMUSG00000091879
AA Change: D215G

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	76	465	7e-26	PFAM
Pfam:NCD3G	508	562	3.5e-18	PFAM
Pfam:7tm_3	593	830	4.8e-55	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

98% (53/54)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	G	A	17: 24,384,460	G542D	possibly damaging	Het
Adh6b	A	G	3: 138,357,689	Y343C	probably damaging	Het
Adsl	T	A	15: 80,952,294		probably null	Het
Apob	T	A	12: 8,007,630		probably null	Het
Atp6ap1l	T	A	13: 90,898,898		probably benign	Het
Cacnb3	A	G	15: 98,639,869	D74G	probably damaging	Het
Clca3a2	T	A	3: 144,806,343	D544V	probably damaging	Het
Col3a1	G	A	1: 45,333,596		probably benign	Het
D7Ertd443e	A	G	7: 134,349,668		probably null	Het
Dscam	T	C	16: 96,772,437	D775G	probably damaging	Het
Eif2b3	T	A	4: 117,022,211	M16K	probably damaging	Het
Eml5	T	C	12: 98,874,512	Y281C	probably damaging	Het
Epha2	T	A	4: 141,308,865	L204Q	possibly damaging	Het
Filip1l	A	C	16: 57,570,662	I538L	possibly damaging	Het
Gcnt2	T	A	13: 40,918,355	V158D	probably damaging	Het
Gnaq	A	G	19: 16,332,085	N162S	probably benign	Het
Haus5	A	T	7: 30,654,226	N575K	probably benign	Het
Hjurp	A	T	1: 88,275,050	Y71N	possibly damaging	Het
Igsf5	A	G	16: 96,373,079	D103G	probably damaging	Het
Myo10	A	G	15: 25,726,483	D297G	possibly damaging	Het
Net1	C	T	13: 3,886,623	R314H	probably damaging	Het
Olfr1273-ps	C	A	2: 90,296,168	R231L	probably benign	Het
Olfr1301	T	A	2: 111,754,552	V101D	probably damaging	Het
Pcsk4	C	A	10: 80,322,145	Q586H	probably null	Het
Pramef6	A	T	4: 143,897,136	M156K	probably benign	Het
Prss1	A	G	6: 41,463,197	D156G	possibly damaging	Het
Rnf133	A	T	6: 23,649,260	N266K	probably damaging	Het
Setd2	G	T	9: 110,617,527	A2482S	possibly damaging	Het
Sgo2a	A	T	1: 58,016,567	S637C	probably damaging	Het
Slc2a5	C	A	4: 150,139,805	S290*	probably null	Het
Spata6	T	G	4: 111,768,795	H120Q	possibly damaging	Het
Stk11	G	A	10: 80,127,941	V194I	probably damaging	Het
Tkt	T	C	14: 30,565,646	V199A	probably benign	Het
Traf3	G	A	12: 111,243,518	V183M	possibly damaging	Het
Trappc11	T	C	8: 47,513,402	Y483C	probably damaging	Het
Trappc9	T	C	15: 72,913,366		probably benign	Het
Trim59	T	C	3: 69,037,734	H91R	probably benign	Het
Ttc21a	A	G	9: 119,952,212	S484G	probably benign	Het
Usp13	A	T	3: 32,915,798	H691L	probably benign	Het
Vmn1r238	T	C	18: 3,123,243	Y57C	probably benign	Het
Vmn2r111	T	A	17: 22,571,143	Q294L	possibly damaging	Het
Wdr66	A	G	5: 123,273,633		probably benign	Het
Zfp280b	A	G	10: 76,039,349	D354G	probably benign	Het
Zfp607a	A	G	7: 27,879,098	H531R	probably damaging	Het
Zfp74	A	T	7: 29,934,733	C517S	probably damaging	Het

Other mutations in Vmn2r17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Vmn2r17	APN	5	109427992	missense	probably benign	0.15
IGL01457:Vmn2r17	APN	5	109453032	missense	probably benign	0.00
IGL01527:Vmn2r17	APN	5	109453140	missense	probably damaging	1.00
IGL01693:Vmn2r17	APN	5	109452518	missense	probably damaging	1.00
IGL01738:Vmn2r17	APN	5	109429498	missense	probably damaging	1.00
IGL01767:Vmn2r17	APN	5	109420037	missense	probably benign	0.01
IGL01932:Vmn2r17	APN	5	109427050	missense	probably benign	0.00
IGL01970:Vmn2r17	APN	5	109427947	missense	probably damaging	0.97
IGL02009:Vmn2r17	APN	5	109452848	missense	possibly damaging	0.67
IGL02365:Vmn2r17	APN	5	109453309	missense	probably damaging	1.00
IGL02385:Vmn2r17	APN	5	109434381	missense	probably damaging	1.00
IGL02457:Vmn2r17	APN	5	109453146	missense	probably damaging	1.00
IGL02646:Vmn2r17	APN	5	109453080	missense	probably damaging	1.00
IGL02741:Vmn2r17	APN	5	109420211	missense	probably benign
IGL03213:Vmn2r17	APN	5	109434390	critical splice donor site	probably null
IGL03216:Vmn2r17	APN	5	109452890	missense	probably damaging	1.00
IGL03342:Vmn2r17	APN	5	109427916	missense	probably damaging	1.00
IGL03408:Vmn2r17	APN	5	109429372	splice site	probably benign
R0349:Vmn2r17	UTSW	5	109428336	missense	probably damaging	1.00
R0418:Vmn2r17	UTSW	5	109452881	missense	probably damaging	1.00
R0800:Vmn2r17	UTSW	5	109427326	splice site	probably benign
R0836:Vmn2r17	UTSW	5	109427956	missense	possibly damaging	0.89
R1715:Vmn2r17	UTSW	5	109428244	missense	probably benign	0.00
R1738:Vmn2r17	UTSW	5	109428511	missense	probably benign	0.10
R1801:Vmn2r17	UTSW	5	109428478	missense	probably damaging	1.00
R2054:Vmn2r17	UTSW	5	109452486	missense	probably damaging	0.98
R2060:Vmn2r17	UTSW	5	109427209	missense	probably benign	0.00
R2192:Vmn2r17	UTSW	5	109434278	missense	possibly damaging	0.81
R2315:Vmn2r17	UTSW	5	109428031	missense	probably damaging	1.00
R2374:Vmn2r17	UTSW	5	109427238	missense	probably benign
R3612:Vmn2r17	UTSW	5	109429597	missense	probably benign	0.00
R3832:Vmn2r17	UTSW	5	109428396	missense	probably damaging	1.00
R4273:Vmn2r17	UTSW	5	109452966	missense	probably benign	0.44
R4494:Vmn2r17	UTSW	5	109428469	missense	probably damaging	1.00
R4597:Vmn2r17	UTSW	5	109429562	missense	probably benign	0.01
R4675:Vmn2r17	UTSW	5	109427183	missense	probably benign	0.00
R4701:Vmn2r17	UTSW	5	109427983	missense	probably damaging	0.99
R4754:Vmn2r17	UTSW	5	109452849	missense	probably damaging	0.99
R4841:Vmn2r17	UTSW	5	109434380	missense	probably damaging	1.00
R4842:Vmn2r17	UTSW	5	109434380	missense	probably damaging	1.00
R4865:Vmn2r17	UTSW	5	109427119	missense	probably damaging	1.00
R4902:Vmn2r17	UTSW	5	109453354	missense	probably benign	0.14
R4989:Vmn2r17	UTSW	5	109427873	missense	probably benign	0.07
R5101:Vmn2r17	UTSW	5	109428351	missense	probably damaging	0.99
R5109:Vmn2r17	UTSW	5	109429476	missense	probably benign	0.06
R5474:Vmn2r17	UTSW	5	109434284	missense	probably damaging	1.00
R5485:Vmn2r17	UTSW	5	109420106	missense	probably benign	0.06
R5611:Vmn2r17	UTSW	5	109428164	missense	probably damaging	0.97
R5652:Vmn2r17	UTSW	5	109429564	missense	probably benign	0.10
R5717:Vmn2r17	UTSW	5	109427274	missense	possibly damaging	0.94
R5735:Vmn2r17	UTSW	5	109452850	missense	possibly damaging	0.67
R5766:Vmn2r17	UTSW	5	109427273	missense	possibly damaging	0.46
R6645:Vmn2r17	UTSW	5	109428381	missense	probably damaging	1.00
R6786:Vmn2r17	UTSW	5	109427829	missense	probably benign	0.30
R6821:Vmn2r17	UTSW	5	109429465	missense	probably damaging	1.00
R6979:Vmn2r17	UTSW	5	109428399	missense	possibly damaging	0.46
R6984:Vmn2r17	UTSW	5	109452667	missense	probably benign	0.10
R7269:Vmn2r17	UTSW	5	109428471	missense	possibly damaging	0.88
R7509:Vmn2r17	UTSW	5	109427829	missense	probably benign	0.30
R7736:Vmn2r17	UTSW	5	109452891	missense	probably benign	0.05
R7789:Vmn2r17	UTSW	5	109452965	missense	possibly damaging	0.77
R7814:Vmn2r17	UTSW	5	109427873	missense	probably benign	0.07
R7847:Vmn2r17	UTSW	5	109420197	missense	probably damaging	1.00
R7863:Vmn2r17	UTSW	5	109420169	missense	probably benign
R7893:Vmn2r17	UTSW	5	109428078	missense	probably benign	0.05
R7930:Vmn2r17	UTSW	5	109420197	missense	probably damaging	1.00
R7946:Vmn2r17	UTSW	5	109420169	missense	probably benign
R7976:Vmn2r17	UTSW	5	109428078	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- ACAAGCACATTACTTATGGGGATG -3'
(R):5'- TGCCCATCTTCTAAAGCTGAC -3'

Sequencing Primer
(F):5'- ACATTACTTATGGGGATGTTTAATCC -3'
(R):5'- CCATCTTCTAAAGCTGACTTCTAGAG -3'

Posted On

2016-06-15