Incidental Mutation 'R5123:Zfp607a'
ID393398
Institutional Source Beutler Lab
Gene Symbol Zfp607a
Ensembl Gene ENSMUSG00000020420
Gene Namezinc finger protein 607A
SynonymsZfp607, 4732475C15Rik
MMRRC Submission 042711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5123 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27857527-27880825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27879098 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 531 (H531R)
Ref Sequence ENSEMBL: ENSMUSP00000146006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053722] [ENSMUST00000205534] [ENSMUST00000205715]
Predicted Effect probably damaging
Transcript: ENSMUST00000053722
AA Change: H531R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051496
Gene: ENSMUSG00000020420
AA Change: H531R

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.91e-2 SMART
ZnF_C2H2 201 223 3.44e-4 SMART
ZnF_C2H2 229 251 3.83e-2 SMART
ZnF_C2H2 257 279 4.87e-4 SMART
ZnF_C2H2 285 307 1.38e-3 SMART
ZnF_C2H2 313 335 4.17e-3 SMART
ZnF_C2H2 341 363 2.86e-1 SMART
ZnF_C2H2 369 391 5.14e-3 SMART
ZnF_C2H2 397 419 1.2e-3 SMART
ZnF_C2H2 425 447 4.47e-3 SMART
ZnF_C2H2 453 475 1.1e-2 SMART
ZnF_C2H2 481 503 1.45e-2 SMART
ZnF_C2H2 509 531 1.12e-3 SMART
ZnF_C2H2 537 559 1.5e-4 SMART
ZnF_C2H2 565 587 8.34e-3 SMART
ZnF_C2H2 593 615 1.12e-3 SMART
ZnF_C2H2 621 643 6.42e-4 SMART
ZnF_C2H2 649 671 6.23e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205534
AA Change: H531R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000205715
AA Change: H531R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206136
Meta Mutation Damage Score 0.5629 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,384,460 G542D possibly damaging Het
Adh6b A G 3: 138,357,689 Y343C probably damaging Het
Adsl T A 15: 80,952,294 probably null Het
Apob T A 12: 8,007,630 probably null Het
Atp6ap1l T A 13: 90,898,898 probably benign Het
Cacnb3 A G 15: 98,639,869 D74G probably damaging Het
Clca3a2 T A 3: 144,806,343 D544V probably damaging Het
Col3a1 G A 1: 45,333,596 probably benign Het
D7Ertd443e A G 7: 134,349,668 probably null Het
Dscam T C 16: 96,772,437 D775G probably damaging Het
Eif2b3 T A 4: 117,022,211 M16K probably damaging Het
Eml5 T C 12: 98,874,512 Y281C probably damaging Het
Epha2 T A 4: 141,308,865 L204Q possibly damaging Het
Filip1l A C 16: 57,570,662 I538L possibly damaging Het
Gcnt2 T A 13: 40,918,355 V158D probably damaging Het
Gnaq A G 19: 16,332,085 N162S probably benign Het
Haus5 A T 7: 30,654,226 N575K probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Igsf5 A G 16: 96,373,079 D103G probably damaging Het
Myo10 A G 15: 25,726,483 D297G possibly damaging Het
Net1 C T 13: 3,886,623 R314H probably damaging Het
Olfr1273-ps C A 2: 90,296,168 R231L probably benign Het
Olfr1301 T A 2: 111,754,552 V101D probably damaging Het
Pcsk4 C A 10: 80,322,145 Q586H probably null Het
Pramef6 A T 4: 143,897,136 M156K probably benign Het
Prss1 A G 6: 41,463,197 D156G possibly damaging Het
Rnf133 A T 6: 23,649,260 N266K probably damaging Het
Setd2 G T 9: 110,617,527 A2482S possibly damaging Het
Sgo2a A T 1: 58,016,567 S637C probably damaging Het
Slc2a5 C A 4: 150,139,805 S290* probably null Het
Spata6 T G 4: 111,768,795 H120Q possibly damaging Het
Stk11 G A 10: 80,127,941 V194I probably damaging Het
Tkt T C 14: 30,565,646 V199A probably benign Het
Traf3 G A 12: 111,243,518 V183M possibly damaging Het
Trappc11 T C 8: 47,513,402 Y483C probably damaging Het
Trappc9 T C 15: 72,913,366 probably benign Het
Trim59 T C 3: 69,037,734 H91R probably benign Het
Ttc21a A G 9: 119,952,212 S484G probably benign Het
Usp13 A T 3: 32,915,798 H691L probably benign Het
Vmn1r238 T C 18: 3,123,243 Y57C probably benign Het
Vmn2r111 T A 17: 22,571,143 Q294L possibly damaging Het
Vmn2r17 A G 5: 109,427,908 D215G possibly damaging Het
Wdr66 A G 5: 123,273,633 probably benign Het
Zfp280b A G 10: 76,039,349 D354G probably benign Het
Zfp74 A T 7: 29,934,733 C517S probably damaging Het
Other mutations in Zfp607a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Zfp607a APN 7 27877789 missense possibly damaging 0.55
IGL01019:Zfp607a APN 7 27878617 missense probably damaging 1.00
IGL01412:Zfp607a APN 7 27878684 missense probably damaging 0.99
IGL03206:Zfp607a APN 7 27877823 missense possibly damaging 0.52
R0071:Zfp607a UTSW 7 27878269 missense probably damaging 0.96
R0304:Zfp607a UTSW 7 27879212 missense possibly damaging 0.92
R0685:Zfp607a UTSW 7 27878476 missense probably damaging 0.97
R0726:Zfp607a UTSW 7 27879149 missense probably benign 0.00
R1201:Zfp607a UTSW 7 27879311 missense probably damaging 1.00
R1304:Zfp607a UTSW 7 27865575 missense probably benign 0.00
R1648:Zfp607a UTSW 7 27879068 missense probably benign 0.02
R1732:Zfp607a UTSW 7 27878459 missense probably damaging 1.00
R2194:Zfp607a UTSW 7 27879380 missense possibly damaging 0.73
R3793:Zfp607a UTSW 7 27878906 missense probably benign 0.01
R3808:Zfp607a UTSW 7 27879401 missense probably benign 0.01
R4296:Zfp607a UTSW 7 27865648 missense probably damaging 1.00
R4786:Zfp607a UTSW 7 27879413 missense probably damaging 1.00
R4792:Zfp607a UTSW 7 27878653 missense probably benign 0.23
R4915:Zfp607a UTSW 7 27878560 missense probably benign 0.00
R4950:Zfp607a UTSW 7 27878751 missense probably damaging 1.00
R5217:Zfp607a UTSW 7 27877844 missense probably damaging 0.97
R5270:Zfp607a UTSW 7 27878305 nonsense probably null
R5403:Zfp607a UTSW 7 27879319 missense possibly damaging 0.54
R6010:Zfp607a UTSW 7 27877829 nonsense probably null
R6224:Zfp607a UTSW 7 27878582 missense probably damaging 1.00
R6939:Zfp607a UTSW 7 27879048 nonsense probably null
R6953:Zfp607a UTSW 7 27878365 missense possibly damaging 0.59
R7082:Zfp607a UTSW 7 27878758 missense probably damaging 1.00
R7781:Zfp607a UTSW 7 27865575 missense possibly damaging 0.90
R7909:Zfp607a UTSW 7 27879094 missense probably damaging 1.00
R8191:Zfp607a UTSW 7 27879443 missense possibly damaging 0.93
R8224:Zfp607a UTSW 7 27878111 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGACGTAAGGACCAGCTTAGTG -3'
(R):5'- TAGTGGTATTGAAAGGCTTCCC -3'

Sequencing Primer
(F):5'- AGCCCTTCAACTGTAAGGACTGTG -3'
(R):5'- GCACTGATAGGGTTTCACATCAG -3'
Posted On2016-06-15