Incidental Mutation 'R5123:Zfp74'
ID393399
Institutional Source Beutler Lab
Gene Symbol Zfp74
Ensembl Gene ENSMUSG00000059975
Gene Namezinc finger protein 74
SynonymsKRAB8, 2810054M15Rik, Zfp66
MMRRC Submission 042711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5123 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29930815-29954089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29934733 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 517 (C517S)
Ref Sequence ENSEMBL: ENSMUSP00000103840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032797] [ENSMUST00000108205] [ENSMUST00000108211] [ENSMUST00000108212]
Predicted Effect probably damaging
Transcript: ENSMUST00000032797
AA Change: C517S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032797
Gene: ENSMUSG00000059975
AA Change: C517S

DomainStartEndE-ValueType
KRAB 8 68 5.02e-38 SMART
ZnF_C2H2 179 201 1.84e-4 SMART
ZnF_C2H2 207 229 2.36e-2 SMART
ZnF_C2H2 235 257 1.5e-4 SMART
ZnF_C2H2 263 285 2.79e-4 SMART
ZnF_C2H2 291 313 3.49e-5 SMART
ZnF_C2H2 319 341 6.42e-4 SMART
ZnF_C2H2 347 369 5.59e-4 SMART
ZnF_C2H2 375 397 5.21e-4 SMART
ZnF_C2H2 403 425 3.63e-3 SMART
ZnF_C2H2 431 453 1.82e-3 SMART
ZnF_C2H2 459 481 1.58e-3 SMART
ZnF_C2H2 487 509 2.12e-4 SMART
ZnF_C2H2 515 537 1.82e-3 SMART
ZnF_C2H2 543 565 2.24e-3 SMART
ZnF_C2H2 571 593 8.02e-5 SMART
ZnF_C2H2 599 621 1.04e-3 SMART
ZnF_C2H2 627 649 1.04e-3 SMART
ZnF_C2H2 655 677 9.88e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108205
AA Change: C517S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103840
Gene: ENSMUSG00000059975
AA Change: C517S

DomainStartEndE-ValueType
KRAB 8 68 5.02e-38 SMART
ZnF_C2H2 179 201 1.84e-4 SMART
ZnF_C2H2 207 229 2.36e-2 SMART
ZnF_C2H2 235 257 1.5e-4 SMART
ZnF_C2H2 263 285 2.79e-4 SMART
ZnF_C2H2 291 313 3.49e-5 SMART
ZnF_C2H2 319 341 6.42e-4 SMART
ZnF_C2H2 347 369 5.59e-4 SMART
ZnF_C2H2 375 397 5.21e-4 SMART
ZnF_C2H2 403 425 3.63e-3 SMART
ZnF_C2H2 431 453 1.82e-3 SMART
ZnF_C2H2 459 481 1.58e-3 SMART
ZnF_C2H2 487 509 2.12e-4 SMART
ZnF_C2H2 515 537 1.82e-3 SMART
ZnF_C2H2 543 565 2.24e-3 SMART
ZnF_C2H2 571 593 8.02e-5 SMART
ZnF_C2H2 599 621 1.04e-3 SMART
ZnF_C2H2 627 649 1.04e-3 SMART
ZnF_C2H2 655 677 9.88e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108211
SMART Domains Protein: ENSMUSP00000103846
Gene: ENSMUSG00000059975

DomainStartEndE-ValueType
KRAB 8 68 5.02e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108212
SMART Domains Protein: ENSMUSP00000103847
Gene: ENSMUSG00000059975

DomainStartEndE-ValueType
KRAB 8 68 5.02e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208490
Meta Mutation Damage Score 0.9429 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,384,460 G542D possibly damaging Het
Adh6b A G 3: 138,357,689 Y343C probably damaging Het
Adsl T A 15: 80,952,294 probably null Het
Apob T A 12: 8,007,630 probably null Het
Atp6ap1l T A 13: 90,898,898 probably benign Het
Cacnb3 A G 15: 98,639,869 D74G probably damaging Het
Clca3a2 T A 3: 144,806,343 D544V probably damaging Het
Col3a1 G A 1: 45,333,596 probably benign Het
D7Ertd443e A G 7: 134,349,668 probably null Het
Dscam T C 16: 96,772,437 D775G probably damaging Het
Eif2b3 T A 4: 117,022,211 M16K probably damaging Het
Eml5 T C 12: 98,874,512 Y281C probably damaging Het
Epha2 T A 4: 141,308,865 L204Q possibly damaging Het
Filip1l A C 16: 57,570,662 I538L possibly damaging Het
Gcnt2 T A 13: 40,918,355 V158D probably damaging Het
Gnaq A G 19: 16,332,085 N162S probably benign Het
Haus5 A T 7: 30,654,226 N575K probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Igsf5 A G 16: 96,373,079 D103G probably damaging Het
Myo10 A G 15: 25,726,483 D297G possibly damaging Het
Net1 C T 13: 3,886,623 R314H probably damaging Het
Olfr1273-ps C A 2: 90,296,168 R231L probably benign Het
Olfr1301 T A 2: 111,754,552 V101D probably damaging Het
Pcsk4 C A 10: 80,322,145 Q586H probably null Het
Pramef6 A T 4: 143,897,136 M156K probably benign Het
Prss1 A G 6: 41,463,197 D156G possibly damaging Het
Rnf133 A T 6: 23,649,260 N266K probably damaging Het
Setd2 G T 9: 110,617,527 A2482S possibly damaging Het
Sgo2a A T 1: 58,016,567 S637C probably damaging Het
Slc2a5 C A 4: 150,139,805 S290* probably null Het
Spata6 T G 4: 111,768,795 H120Q possibly damaging Het
Stk11 G A 10: 80,127,941 V194I probably damaging Het
Tkt T C 14: 30,565,646 V199A probably benign Het
Traf3 G A 12: 111,243,518 V183M possibly damaging Het
Trappc11 T C 8: 47,513,402 Y483C probably damaging Het
Trappc9 T C 15: 72,913,366 probably benign Het
Trim59 T C 3: 69,037,734 H91R probably benign Het
Ttc21a A G 9: 119,952,212 S484G probably benign Het
Usp13 A T 3: 32,915,798 H691L probably benign Het
Vmn1r238 T C 18: 3,123,243 Y57C probably benign Het
Vmn2r111 T A 17: 22,571,143 Q294L possibly damaging Het
Vmn2r17 A G 5: 109,427,908 D215G possibly damaging Het
Wdr66 A G 5: 123,273,633 probably benign Het
Zfp280b A G 10: 76,039,349 D354G probably benign Het
Zfp607a A G 7: 27,879,098 H531R probably damaging Het
Other mutations in Zfp74
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0355:Zfp74 UTSW 7 29954041 start gained probably benign
R0387:Zfp74 UTSW 7 29934754 missense probably benign 0.05
R0948:Zfp74 UTSW 7 29935937 critical splice donor site probably null
R1757:Zfp74 UTSW 7 29935061 missense probably benign 0.01
R1813:Zfp74 UTSW 7 29935144 missense probably damaging 1.00
R1893:Zfp74 UTSW 7 29936045 critical splice acceptor site probably null
R1896:Zfp74 UTSW 7 29935144 missense probably damaging 1.00
R1958:Zfp74 UTSW 7 29935711 missense probably benign 0.08
R2092:Zfp74 UTSW 7 29953924 start gained probably benign
R2111:Zfp74 UTSW 7 29935018 nonsense probably null
R4894:Zfp74 UTSW 7 29936045 critical splice acceptor site probably benign
R5121:Zfp74 UTSW 7 29932507 intron probably null
R5129:Zfp74 UTSW 7 29932455 missense probably benign 0.00
R5213:Zfp74 UTSW 7 29935243 missense probably damaging 1.00
R5460:Zfp74 UTSW 7 29935891 missense probably benign 0.04
R5519:Zfp74 UTSW 7 29935134 missense probably damaging 0.99
R5589:Zfp74 UTSW 7 29934565 missense probably damaging 1.00
R6287:Zfp74 UTSW 7 29935776 missense probably benign
R6330:Zfp74 UTSW 7 29937987 missense probably damaging 1.00
R6370:Zfp74 UTSW 7 29932410 missense probably damaging 0.96
R6407:Zfp74 UTSW 7 29935623 missense probably damaging 1.00
R6694:Zfp74 UTSW 7 29935134 missense probably damaging 0.99
R6791:Zfp74 UTSW 7 29934435 missense probably benign 0.02
R7144:Zfp74 UTSW 7 29935165 missense probably damaging 0.98
R7662:Zfp74 UTSW 7 29953853 critical splice donor site probably null
R7667:Zfp74 UTSW 7 29935183 missense probably damaging 1.00
R7898:Zfp74 UTSW 7 29935955 nonsense probably null
R7981:Zfp74 UTSW 7 29935955 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTTACACACGTACGGCTTCTC -3'
(R):5'- AAGGCCTTCTCTCAGAGCTC -3'

Sequencing Primer
(F):5'- GGCTTCTCCCCTGTGTGG -3'
(R):5'- GATGTCAAACCTTGTCAGGC -3'
Posted On2016-06-15