Incidental Mutation 'R5123:Haus5'
ID393400
Institutional Source Beutler Lab
Gene Symbol Haus5
Ensembl Gene ENSMUSG00000078762
Gene NameHAUS augmin-like complex, subunit 5
Synonyms2310022K01Rik
MMRRC Submission 042711-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R5123 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30653711-30664994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30654226 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 575 (N575K)
Ref Sequence ENSEMBL: ENSMUSP00000019697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019697] [ENSMUST00000042726] [ENSMUST00000108141] [ENSMUST00000132862]
Predicted Effect probably benign
Transcript: ENSMUST00000019697
AA Change: N575K

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000019697
Gene: ENSMUSG00000078762
AA Change: N575K

DomainStartEndE-ValueType
Pfam:HAUS5 7 617 9.8e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042726
SMART Domains Protein: ENSMUSP00000040005
Gene: ENSMUSG00000036733

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 75 86 N/A INTRINSIC
low complexity region 101 126 N/A INTRINSIC
low complexity region 192 217 N/A INTRINSIC
low complexity region 220 243 N/A INTRINSIC
low complexity region 247 277 N/A INTRINSIC
low complexity region 279 333 N/A INTRINSIC
low complexity region 339 355 N/A INTRINSIC
RRM 380 453 1.11e-21 SMART
low complexity region 467 474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108141
SMART Domains Protein: ENSMUSP00000103776
Gene: ENSMUSG00000036733

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 75 86 N/A INTRINSIC
low complexity region 101 126 N/A INTRINSIC
low complexity region 163 188 N/A INTRINSIC
low complexity region 191 214 N/A INTRINSIC
low complexity region 218 248 N/A INTRINSIC
low complexity region 250 304 N/A INTRINSIC
low complexity region 310 326 N/A INTRINSIC
RRM 351 424 1.11e-21 SMART
low complexity region 438 445 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126511
Predicted Effect probably benign
Transcript: ENSMUST00000132862
SMART Domains Protein: ENSMUSP00000121739
Gene: ENSMUSG00000078762

DomainStartEndE-ValueType
Pfam:HAUS5 5 515 4.4e-182 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181529
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HAUS5 is 1 of 8 subunits of the 390-kD human augmin complex, or HAUS complex. The augmin complex was first identified in Drosophila, and its name comes from the Latin verb 'augmentare,' meaning 'to increase.' The augmin complex is a microtubule-binding complex involved in microtubule generation within the mitotic spindle and is vital to mitotic spindle assembly (Goshima et al., 2008 [PubMed 18443220]; Uehara et al., 2009 [PubMed 19369198]).[supplied by OMIM, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,384,460 G542D possibly damaging Het
Adh6b A G 3: 138,357,689 Y343C probably damaging Het
Adsl T A 15: 80,952,294 probably null Het
Apob T A 12: 8,007,630 probably null Het
Atp6ap1l T A 13: 90,898,898 probably benign Het
Cacnb3 A G 15: 98,639,869 D74G probably damaging Het
Clca3a2 T A 3: 144,806,343 D544V probably damaging Het
Col3a1 G A 1: 45,333,596 probably benign Het
D7Ertd443e A G 7: 134,349,668 probably null Het
Dscam T C 16: 96,772,437 D775G probably damaging Het
Eif2b3 T A 4: 117,022,211 M16K probably damaging Het
Eml5 T C 12: 98,874,512 Y281C probably damaging Het
Epha2 T A 4: 141,308,865 L204Q possibly damaging Het
Filip1l A C 16: 57,570,662 I538L possibly damaging Het
Gcnt2 T A 13: 40,918,355 V158D probably damaging Het
Gnaq A G 19: 16,332,085 N162S probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Igsf5 A G 16: 96,373,079 D103G probably damaging Het
Myo10 A G 15: 25,726,483 D297G possibly damaging Het
Net1 C T 13: 3,886,623 R314H probably damaging Het
Olfr1273-ps C A 2: 90,296,168 R231L probably benign Het
Olfr1301 T A 2: 111,754,552 V101D probably damaging Het
Pcsk4 C A 10: 80,322,145 Q586H probably null Het
Pramef6 A T 4: 143,897,136 M156K probably benign Het
Prss1 A G 6: 41,463,197 D156G possibly damaging Het
Rnf133 A T 6: 23,649,260 N266K probably damaging Het
Setd2 G T 9: 110,617,527 A2482S possibly damaging Het
Sgo2a A T 1: 58,016,567 S637C probably damaging Het
Slc2a5 C A 4: 150,139,805 S290* probably null Het
Spata6 T G 4: 111,768,795 H120Q possibly damaging Het
Stk11 G A 10: 80,127,941 V194I probably damaging Het
Tkt T C 14: 30,565,646 V199A probably benign Het
Traf3 G A 12: 111,243,518 V183M possibly damaging Het
Trappc11 T C 8: 47,513,402 Y483C probably damaging Het
Trappc9 T C 15: 72,913,366 probably benign Het
Trim59 T C 3: 69,037,734 H91R probably benign Het
Ttc21a A G 9: 119,952,212 S484G probably benign Het
Usp13 A T 3: 32,915,798 H691L probably benign Het
Vmn1r238 T C 18: 3,123,243 Y57C probably benign Het
Vmn2r111 T A 17: 22,571,143 Q294L possibly damaging Het
Vmn2r17 A G 5: 109,427,908 D215G possibly damaging Het
Wdr66 A G 5: 123,273,633 probably benign Het
Zfp280b A G 10: 76,039,349 D354G probably benign Het
Zfp607a A G 7: 27,879,098 H531R probably damaging Het
Zfp74 A T 7: 29,934,733 C517S probably damaging Het
Other mutations in Haus5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Haus5 APN 7 30663294 splice site probably benign
IGL02422:Haus5 APN 7 30660146 missense possibly damaging 0.95
IGL02427:Haus5 APN 7 30661771 missense probably benign
IGL02626:Haus5 APN 7 30657250 missense probably damaging 1.00
IGL02695:Haus5 APN 7 30663277 missense probably damaging 1.00
R0046:Haus5 UTSW 7 30654180 missense probably benign 0.10
R0046:Haus5 UTSW 7 30654180 missense probably benign 0.10
R0511:Haus5 UTSW 7 30659067 missense probably damaging 1.00
R0547:Haus5 UTSW 7 30659083 missense probably damaging 0.96
R1447:Haus5 UTSW 7 30661791 splice site probably null
R1711:Haus5 UTSW 7 30657903 nonsense probably null
R1852:Haus5 UTSW 7 30658501 critical splice donor site probably null
R1901:Haus5 UTSW 7 30657245 missense probably damaging 1.00
R2029:Haus5 UTSW 7 30659400 missense possibly damaging 0.95
R4832:Haus5 UTSW 7 30657027 missense probably damaging 0.97
R4865:Haus5 UTSW 7 30658555 missense probably damaging 1.00
R5168:Haus5 UTSW 7 30657711 missense possibly damaging 0.95
R5492:Haus5 UTSW 7 30658955 missense possibly damaging 0.69
R6293:Haus5 UTSW 7 30658976 nonsense probably null
R6296:Haus5 UTSW 7 30658976 nonsense probably null
R6297:Haus5 UTSW 7 30658976 nonsense probably null
R6332:Haus5 UTSW 7 30658976 nonsense probably null
R6334:Haus5 UTSW 7 30658976 nonsense probably null
R6964:Haus5 UTSW 7 30657615 missense probably benign 0.41
R7095:Haus5 UTSW 7 30659572 missense probably benign 0.06
R7348:Haus5 UTSW 7 30656966 missense possibly damaging 0.94
R7740:Haus5 UTSW 7 30663253 missense possibly damaging 0.92
R8329:Haus5 UTSW 7 30659559 missense possibly damaging 0.85
U24488:Haus5 UTSW 7 30658976 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATTGCAAGTCTTGACTCTGCTTC -3'
(R):5'- AAGCTGTGCCTGTGTCAGAG -3'

Sequencing Primer
(F):5'- TACCTGGGCCTACACTCAG -3'
(R):5'- CCTGTGTCAGAGCCTGGTAG -3'
Posted On2016-06-15