Incidental Mutation 'R5123:D7Ertd443e'
ID393401
Institutional Source Beutler Lab
Gene Symbol D7Ertd443e
Ensembl Gene ENSMUSG00000030994
Gene NameDNA segment, Chr 7, ERATO Doi 443, expressed
Synonyms
MMRRC Submission 042711-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5123 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location134265779-134385661 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 134349668 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094002] [ENSMUST00000172947] [ENSMUST00000173195] [ENSMUST00000173754] [ENSMUST00000174700]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094002
AA Change: V45A

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091539
Gene: ENSMUSG00000030994
AA Change: V45A

DomainStartEndE-ValueType
low complexity region 179 192 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 396 410 N/A INTRINSIC
low complexity region 478 494 N/A INTRINSIC
Pfam:ALMS_motif 511 644 3.7e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172947
AA Change: V92A

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134479
Gene: ENSMUSG00000030994
AA Change: V92A

DomainStartEndE-ValueType
low complexity region 226 239 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
low complexity region 525 541 N/A INTRINSIC
Pfam:ALMS_motif 559 689 1.2e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173195
AA Change: V45A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably null
Transcript: ENSMUST00000173754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174271
Predicted Effect probably benign
Transcript: ENSMUST00000174700
SMART Domains Protein: ENSMUSP00000134411
Gene: ENSMUSG00000030994

DomainStartEndE-ValueType
Pfam:ALMS_motif 25 98 2.3e-12 PFAM
Meta Mutation Damage Score 0.4340 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,384,460 G542D possibly damaging Het
Adh6b A G 3: 138,357,689 Y343C probably damaging Het
Adsl T A 15: 80,952,294 probably null Het
Apob T A 12: 8,007,630 probably null Het
Atp6ap1l T A 13: 90,898,898 probably benign Het
Cacnb3 A G 15: 98,639,869 D74G probably damaging Het
Clca3a2 T A 3: 144,806,343 D544V probably damaging Het
Col3a1 G A 1: 45,333,596 probably benign Het
Dscam T C 16: 96,772,437 D775G probably damaging Het
Eif2b3 T A 4: 117,022,211 M16K probably damaging Het
Eml5 T C 12: 98,874,512 Y281C probably damaging Het
Epha2 T A 4: 141,308,865 L204Q possibly damaging Het
Filip1l A C 16: 57,570,662 I538L possibly damaging Het
Gcnt2 T A 13: 40,918,355 V158D probably damaging Het
Gnaq A G 19: 16,332,085 N162S probably benign Het
Haus5 A T 7: 30,654,226 N575K probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Igsf5 A G 16: 96,373,079 D103G probably damaging Het
Myo10 A G 15: 25,726,483 D297G possibly damaging Het
Net1 C T 13: 3,886,623 R314H probably damaging Het
Olfr1273-ps C A 2: 90,296,168 R231L probably benign Het
Olfr1301 T A 2: 111,754,552 V101D probably damaging Het
Pcsk4 C A 10: 80,322,145 Q586H probably null Het
Pramef6 A T 4: 143,897,136 M156K probably benign Het
Prss1 A G 6: 41,463,197 D156G possibly damaging Het
Rnf133 A T 6: 23,649,260 N266K probably damaging Het
Setd2 G T 9: 110,617,527 A2482S possibly damaging Het
Sgo2a A T 1: 58,016,567 S637C probably damaging Het
Slc2a5 C A 4: 150,139,805 S290* probably null Het
Spata6 T G 4: 111,768,795 H120Q possibly damaging Het
Stk11 G A 10: 80,127,941 V194I probably damaging Het
Tkt T C 14: 30,565,646 V199A probably benign Het
Traf3 G A 12: 111,243,518 V183M possibly damaging Het
Trappc11 T C 8: 47,513,402 Y483C probably damaging Het
Trappc9 T C 15: 72,913,366 probably benign Het
Trim59 T C 3: 69,037,734 H91R probably benign Het
Ttc21a A G 9: 119,952,212 S484G probably benign Het
Usp13 A T 3: 32,915,798 H691L probably benign Het
Vmn1r238 T C 18: 3,123,243 Y57C probably benign Het
Vmn2r111 T A 17: 22,571,143 Q294L possibly damaging Het
Vmn2r17 A G 5: 109,427,908 D215G possibly damaging Het
Wdr66 A G 5: 123,273,633 probably benign Het
Zfp280b A G 10: 76,039,349 D354G probably benign Het
Zfp607a A G 7: 27,879,098 H531R probably damaging Het
Zfp74 A T 7: 29,934,733 C517S probably damaging Het
Other mutations in D7Ertd443e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02159:D7Ertd443e APN 7 134349400 missense possibly damaging 0.56
R0369:D7Ertd443e UTSW 7 134298137 missense possibly damaging 0.56
R0501:D7Ertd443e UTSW 7 134294972 missense probably damaging 1.00
R1073:D7Ertd443e UTSW 7 134270218 missense probably damaging 1.00
R1083:D7Ertd443e UTSW 7 134348934 nonsense probably null
R1744:D7Ertd443e UTSW 7 134349413 missense probably benign 0.00
R1801:D7Ertd443e UTSW 7 134270212 missense probably damaging 1.00
R1807:D7Ertd443e UTSW 7 134293305 missense probably null 1.00
R2050:D7Ertd443e UTSW 7 134266798 missense probably damaging 1.00
R2273:D7Ertd443e UTSW 7 134270201 missense probably damaging 1.00
R2274:D7Ertd443e UTSW 7 134270201 missense probably damaging 1.00
R2504:D7Ertd443e UTSW 7 134349479 splice site probably null
R3699:D7Ertd443e UTSW 7 134349068 missense probably damaging 1.00
R4348:D7Ertd443e UTSW 7 134348953 frame shift probably null
R4516:D7Ertd443e UTSW 7 134293328 missense probably damaging 1.00
R5440:D7Ertd443e UTSW 7 134349275 missense probably damaging 0.96
R5555:D7Ertd443e UTSW 7 134349591 missense probably benign 0.00
R5711:D7Ertd443e UTSW 7 134349381 missense probably benign 0.43
R5848:D7Ertd443e UTSW 7 134349722 missense possibly damaging 0.92
R6049:D7Ertd443e UTSW 7 134298232 missense probably benign 0.01
R6266:D7Ertd443e UTSW 7 134349785 missense probably damaging 1.00
R6408:D7Ertd443e UTSW 7 134349711 missense probably benign 0.27
R6939:D7Ertd443e UTSW 7 134364479 splice site probably null
R7195:D7Ertd443e UTSW 7 134295122 missense probably damaging 1.00
R7352:D7Ertd443e UTSW 7 134349394 missense probably benign 0.03
R7737:D7Ertd443e UTSW 7 134270201 missense probably damaging 1.00
R7843:D7Ertd443e UTSW 7 134349095 missense possibly damaging 0.93
R7845:D7Ertd443e UTSW 7 134270248 missense probably damaging 1.00
R8346:D7Ertd443e UTSW 7 134348756 missense possibly damaging 0.63
Z1088:D7Ertd443e UTSW 7 134294982 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGCTTTGCACTTGGGACAC -3'
(R):5'- TCTATTTTCTAGGAGACACTGGC -3'

Sequencing Primer
(F):5'- GTGGGTCCCTAAAAGTGTCCCATAC -3'
(R):5'- TTTCTAGGAGACACTGGCATCACAG -3'
Posted On2016-06-15