Mutagenetix > Incidental Mutations

Incidental Mutation 'R5123:Trappc11'

393402

Institutional Source

Beutler Lab

Gene Symbol

Trappc11

Ensembl Gene

ENSMUSG00000038102

Gene Name

trafficking protein particle complex 11

Synonyms

D030016E14Rik

MMRRC Submission

042711-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5123 (G1)

Quality Score

211

Status

Validated

Chromosome

Chromosomal Location

47490115-47533470 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 47513402 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 483 (Y483C)

Ref Sequence

ENSEMBL: ENSMUSP00000047562 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039061] [ENSMUST00000120987]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039061
AA Change: Y483C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000047562
Gene: ENSMUSG00000038102
AA Change: Y483C

Domain	Start	End	E-Value	Type
Pfam:Foie-gras_1	263	522	3e-78	PFAM
Pfam:Gryzun	978	1114	3.9e-10	PFAM
Pfam:Gryzun-like	1036	1095	2.4e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120987

SMART Domains

Protein: ENSMUSP00000113779
Gene: ENSMUSG00000038102

Domain	Start	End	E-Value	Type
Pfam:Gryzun	1	155	4e-25	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123958

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125065

Meta Mutation Damage Score

0.9403

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. This subunit is involved in early stage endoplasmic reticulum-to-Golgi vesicle transport. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	G	A	17: 24,384,460	G542D	possibly damaging	Het
Adh6b	A	G	3: 138,357,689	Y343C	probably damaging	Het
Adsl	T	A	15: 80,952,294		probably null	Het
Apob	T	A	12: 8,007,630		probably null	Het
Atp6ap1l	T	A	13: 90,898,898		probably benign	Het
Cacnb3	A	G	15: 98,639,869	D74G	probably damaging	Het
Clca3a2	T	A	3: 144,806,343	D544V	probably damaging	Het
Col3a1	G	A	1: 45,333,596		probably benign	Het
D7Ertd443e	A	G	7: 134,349,668		probably null	Het
Dscam	T	C	16: 96,772,437	D775G	probably damaging	Het
Eif2b3	T	A	4: 117,022,211	M16K	probably damaging	Het
Eml5	T	C	12: 98,874,512	Y281C	probably damaging	Het
Epha2	T	A	4: 141,308,865	L204Q	possibly damaging	Het
Filip1l	A	C	16: 57,570,662	I538L	possibly damaging	Het
Gcnt2	T	A	13: 40,918,355	V158D	probably damaging	Het
Gnaq	A	G	19: 16,332,085	N162S	probably benign	Het
Haus5	A	T	7: 30,654,226	N575K	probably benign	Het
Hjurp	A	T	1: 88,275,050	Y71N	possibly damaging	Het
Igsf5	A	G	16: 96,373,079	D103G	probably damaging	Het
Myo10	A	G	15: 25,726,483	D297G	possibly damaging	Het
Net1	C	T	13: 3,886,623	R314H	probably damaging	Het
Olfr1273-ps	C	A	2: 90,296,168	R231L	probably benign	Het
Olfr1301	T	A	2: 111,754,552	V101D	probably damaging	Het
Pcsk4	C	A	10: 80,322,145	Q586H	probably null	Het
Pramef6	A	T	4: 143,897,136	M156K	probably benign	Het
Prss1	A	G	6: 41,463,197	D156G	possibly damaging	Het
Rnf133	A	T	6: 23,649,260	N266K	probably damaging	Het
Setd2	G	T	9: 110,617,527	A2482S	possibly damaging	Het
Sgo2a	A	T	1: 58,016,567	S637C	probably damaging	Het
Slc2a5	C	A	4: 150,139,805	S290*	probably null	Het
Spata6	T	G	4: 111,768,795	H120Q	possibly damaging	Het
Stk11	G	A	10: 80,127,941	V194I	probably damaging	Het
Tkt	T	C	14: 30,565,646	V199A	probably benign	Het
Traf3	G	A	12: 111,243,518	V183M	possibly damaging	Het
Trappc9	T	C	15: 72,913,366		probably benign	Het
Trim59	T	C	3: 69,037,734	H91R	probably benign	Het
Ttc21a	A	G	9: 119,952,212	S484G	probably benign	Het
Usp13	A	T	3: 32,915,798	H691L	probably benign	Het
Vmn1r238	T	C	18: 3,123,243	Y57C	probably benign	Het
Vmn2r111	T	A	17: 22,571,143	Q294L	possibly damaging	Het
Vmn2r17	A	G	5: 109,427,908	D215G	possibly damaging	Het
Wdr66	A	G	5: 123,273,633		probably benign	Het
Zfp280b	A	G	10: 76,039,349	D354G	probably benign	Het
Zfp607a	A	G	7: 27,879,098	H531R	probably damaging	Het
Zfp74	A	T	7: 29,934,733	C517S	probably damaging	Het

Other mutations in Trappc11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Trappc11	APN	8	47503302	unclassified	probably benign
IGL01300:Trappc11	APN	8	47501868	missense	probably benign
IGL01312:Trappc11	APN	8	47505677	missense	possibly damaging	0.95
IGL01344:Trappc11	APN	8	47519704	missense	probably damaging	1.00
IGL01518:Trappc11	APN	8	47501869	splice site	probably null
IGL01747:Trappc11	APN	8	47519621	missense	probably benign	0.41
IGL01781:Trappc11	APN	8	47514128	missense	possibly damaging	0.95
IGL01908:Trappc11	APN	8	47503994	missense	probably damaging	1.00
IGL01956:Trappc11	APN	8	47528001	missense	possibly damaging	0.86
IGL02266:Trappc11	APN	8	47505731	missense	probably damaging	1.00
IGL02377:Trappc11	APN	8	47530650	critical splice donor site	probably null
IGL02530:Trappc11	APN	8	47507582	missense	probably damaging	1.00
IGL02676:Trappc11	APN	8	47493413	splice site	probably benign
IGL03030:Trappc11	APN	8	47513929	missense	probably damaging	0.98
IGL03393:Trappc11	APN	8	47510877	missense	possibly damaging	0.95
bunyoro	UTSW	8	47512285	splice site	probably null
nyoro	UTSW	8	47526979	missense	possibly damaging	0.73
serval	UTSW	8	47503965	missense	probably damaging	1.00
R0009:Trappc11	UTSW	8	47503320	missense	possibly damaging	0.70
R0009:Trappc11	UTSW	8	47503320	missense	possibly damaging	0.70
R0043:Trappc11	UTSW	8	47505575	splice site	probably benign
R0180:Trappc11	UTSW	8	47527974	missense	possibly damaging	0.86
R0529:Trappc11	UTSW	8	47526979	missense	possibly damaging	0.73
R0538:Trappc11	UTSW	8	47503412	missense	probably benign	0.01
R0740:Trappc11	UTSW	8	47524588	missense	probably damaging	0.99
R1352:Trappc11	UTSW	8	47525046	missense	possibly damaging	0.90
R1469:Trappc11	UTSW	8	47503965	missense	probably damaging	1.00
R1469:Trappc11	UTSW	8	47503965	missense	probably damaging	1.00
R1502:Trappc11	UTSW	8	47530827	missense	possibly damaging	0.94
R1589:Trappc11	UTSW	8	47501680	missense	probably damaging	1.00
R1741:Trappc11	UTSW	8	47529327	critical splice donor site	probably null
R2292:Trappc11	UTSW	8	47505736	missense	probably damaging	1.00
R2303:Trappc11	UTSW	8	47503416	missense	probably damaging	0.99
R2931:Trappc11	UTSW	8	47503942	missense	probably damaging	0.99
R3522:Trappc11	UTSW	8	47498673	missense	possibly damaging	0.93
R3714:Trappc11	UTSW	8	47505316	intron	probably benign
R3739:Trappc11	UTSW	8	47514103	missense	probably damaging	0.98
R4165:Trappc11	UTSW	8	47524968	splice site	probably benign
R4581:Trappc11	UTSW	8	47493345	missense	probably damaging	0.97
R4598:Trappc11	UTSW	8	47513766	missense	probably damaging	0.98
R4939:Trappc11	UTSW	8	47519665	missense	probably damaging	1.00
R4990:Trappc11	UTSW	8	47490895	missense	probably benign	0.41
R4994:Trappc11	UTSW	8	47522441	nonsense	probably null
R5091:Trappc11	UTSW	8	47512604	missense	probably benign	0.00
R5176:Trappc11	UTSW	8	47510963	missense	possibly damaging	0.79
R5279:Trappc11	UTSW	8	47505304	intron	probably benign
R5293:Trappc11	UTSW	8	47493342	missense	possibly damaging	0.83
R5294:Trappc11	UTSW	8	47530731	missense	possibly damaging	0.88
R5661:Trappc11	UTSW	8	47512607	missense	probably damaging	0.99
R5838:Trappc11	UTSW	8	47512559	critical splice donor site	probably null
R5889:Trappc11	UTSW	8	47519578	missense	probably benign	0.40
R5952:Trappc11	UTSW	8	47496917	critical splice donor site	probably null
R5959:Trappc11	UTSW	8	47501558	missense	probably damaging	0.97
R6239:Trappc11	UTSW	8	47529494	missense	possibly damaging	0.73
R6322:Trappc11	UTSW	8	47530773	missense	possibly damaging	0.95
R6369:Trappc11	UTSW	8	47512285	splice site	probably null
R7541:Trappc11	UTSW	8	47505582	splice site	probably null
R7544:Trappc11	UTSW	8	47522414	missense	possibly damaging	0.73
R7762:Trappc11	UTSW	8	47522376	missense	probably damaging	0.99
R7964:Trappc11	UTSW	8	47526944	missense	possibly damaging	0.54
R8183:Trappc11	UTSW	8	47529356	missense	possibly damaging	0.93
R8282:Trappc11	UTSW	8	47516589	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CGATGCAAACTACTGTCTGAGC -3'
(R):5'- CTGTGTCTGTTGTTACTAAATTCCAGC -3'

Sequencing Primer
(F):5'- AAACTACTGTCTGAGCTGGGC -3'
(R):5'- TCAATGTCCTCTGCTAGCAAAATC -3'

Posted On

2016-06-15