Incidental Mutation 'R5123:Setd2'
ID393403
Institutional Source Beutler Lab
Gene Symbol Setd2
Ensembl Gene ENSMUSG00000044791
Gene NameSET domain containing 2
Synonyms4921524K10Rik, KMT3A
MMRRC Submission 042711-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.898) question?
Stock #R5123 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location110532597-110618633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 110617527 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 2482 (A2482S)
Ref Sequence ENSEMBL: ENSMUSP00000116313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035069] [ENSMUST00000153838] [ENSMUST00000196735] [ENSMUST00000196876] [ENSMUST00000197399]
Predicted Effect probably benign
Transcript: ENSMUST00000035069
SMART Domains Protein: ENSMUSP00000035069
Gene: ENSMUSG00000032491

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Pfam:Death 143 222 1.7e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000153838
AA Change: A2482S

PolyPhen 2 Score 0.760 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116313
Gene: ENSMUSG00000044791
AA Change: A2482S

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
low complexity region 156 176 N/A INTRINSIC
low complexity region 185 207 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 392 419 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 867 883 N/A INTRINSIC
low complexity region 1015 1039 N/A INTRINSIC
low complexity region 1066 1077 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
AWS 1468 1523 8.39e-30 SMART
SET 1524 1647 3.07e-41 SMART
PostSET 1648 1664 1.27e-5 SMART
Blast:SET 1689 1714 2e-6 BLAST
low complexity region 1884 1909 N/A INTRINSIC
low complexity region 1956 1967 N/A INTRINSIC
coiled coil region 2090 2113 N/A INTRINSIC
low complexity region 2189 2211 N/A INTRINSIC
low complexity region 2248 2265 N/A INTRINSIC
WW 2363 2395 2.1e-11 SMART
Pfam:SRI 2440 2530 6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196735
SMART Domains Protein: ENSMUSP00000143785
Gene: ENSMUSG00000032491

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Pfam:Death 143 200 2.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196814
Predicted Effect probably benign
Transcript: ENSMUST00000196876
SMART Domains Protein: ENSMUSP00000142925
Gene: ENSMUSG00000032491

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197260
Predicted Effect probably benign
Transcript: ENSMUST00000197399
SMART Domains Protein: ENSMUSP00000142572
Gene: ENSMUSG00000044791

DomainStartEndE-ValueType
WW 7 39 2.1e-11 SMART
Predicted Effect unknown
Transcript: ENSMUST00000200460
AA Change: A704S
Meta Mutation Damage Score 0.4701 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein belonging to a class of huntingtin interacting proteins characterized by WW motifs. This protein is a histone methyltransferase that is specific for lysine-36 of histone H3, and methylation of this residue is associated with active chromatin. This protein also contains a novel transcriptional activation domain and has been found associated with hyperphosphorylated RNA polymerase II. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired embryonic vascular remodeling in the embryo proper, yolk sac, and placenta that leads to death around E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,384,460 G542D possibly damaging Het
Adh6b A G 3: 138,357,689 Y343C probably damaging Het
Adsl T A 15: 80,952,294 probably null Het
Apob T A 12: 8,007,630 probably null Het
Atp6ap1l T A 13: 90,898,898 probably benign Het
Cacnb3 A G 15: 98,639,869 D74G probably damaging Het
Clca3a2 T A 3: 144,806,343 D544V probably damaging Het
Col3a1 G A 1: 45,333,596 probably benign Het
D7Ertd443e A G 7: 134,349,668 probably null Het
Dscam T C 16: 96,772,437 D775G probably damaging Het
Eif2b3 T A 4: 117,022,211 M16K probably damaging Het
Eml5 T C 12: 98,874,512 Y281C probably damaging Het
Epha2 T A 4: 141,308,865 L204Q possibly damaging Het
Filip1l A C 16: 57,570,662 I538L possibly damaging Het
Gcnt2 T A 13: 40,918,355 V158D probably damaging Het
Gnaq A G 19: 16,332,085 N162S probably benign Het
Haus5 A T 7: 30,654,226 N575K probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Igsf5 A G 16: 96,373,079 D103G probably damaging Het
Myo10 A G 15: 25,726,483 D297G possibly damaging Het
Net1 C T 13: 3,886,623 R314H probably damaging Het
Olfr1273-ps C A 2: 90,296,168 R231L probably benign Het
Olfr1301 T A 2: 111,754,552 V101D probably damaging Het
Pcsk4 C A 10: 80,322,145 Q586H probably null Het
Pramef6 A T 4: 143,897,136 M156K probably benign Het
Prss1 A G 6: 41,463,197 D156G possibly damaging Het
Rnf133 A T 6: 23,649,260 N266K probably damaging Het
Sgo2a A T 1: 58,016,567 S637C probably damaging Het
Slc2a5 C A 4: 150,139,805 S290* probably null Het
Spata6 T G 4: 111,768,795 H120Q possibly damaging Het
Stk11 G A 10: 80,127,941 V194I probably damaging Het
Tkt T C 14: 30,565,646 V199A probably benign Het
Traf3 G A 12: 111,243,518 V183M possibly damaging Het
Trappc11 T C 8: 47,513,402 Y483C probably damaging Het
Trappc9 T C 15: 72,913,366 probably benign Het
Trim59 T C 3: 69,037,734 H91R probably benign Het
Ttc21a A G 9: 119,952,212 S484G probably benign Het
Usp13 A T 3: 32,915,798 H691L probably benign Het
Vmn1r238 T C 18: 3,123,243 Y57C probably benign Het
Vmn2r111 T A 17: 22,571,143 Q294L possibly damaging Het
Vmn2r17 A G 5: 109,427,908 D215G possibly damaging Het
Wdr66 A G 5: 123,273,633 probably benign Het
Zfp280b A G 10: 76,039,349 D354G probably benign Het
Zfp607a A G 7: 27,879,098 H531R probably damaging Het
Zfp74 A T 7: 29,934,733 C517S probably damaging Het
Other mutations in Setd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Setd2 APN 9 110551136 missense possibly damaging 0.94
IGL01023:Setd2 APN 9 110547513 nonsense probably null
IGL01063:Setd2 APN 9 110573673 missense probably damaging 1.00
IGL01745:Setd2 APN 9 110594711 missense probably damaging 0.99
IGL01911:Setd2 APN 9 110617431 splice site probably null
IGL01955:Setd2 APN 9 110549318 missense probably benign 0.38
IGL02023:Setd2 APN 9 110594636 missense probably benign 0.06
IGL02080:Setd2 APN 9 110547450 splice site probably null
IGL02412:Setd2 APN 9 110550774 missense probably benign 0.00
IGL02519:Setd2 APN 9 110553116 missense probably damaging 0.97
IGL02631:Setd2 APN 9 110550576 missense possibly damaging 0.80
IGL02754:Setd2 APN 9 110550056 missense possibly damaging 0.77
IGL02828:Setd2 APN 9 110561214 missense probably benign 0.31
IGL03033:Setd2 APN 9 110551275 missense possibly damaging 0.96
IGL03140:Setd2 APN 9 110614952 critical splice donor site probably null
IGL03378:Setd2 APN 9 110553152 missense unknown
American_samoa UTSW 9 110567758 nonsense probably null
slingshot UTSW 9 110549507 missense probably benign 0.00
P0028:Setd2 UTSW 9 110573954 missense probably benign 0.00
PIT4544001:Setd2 UTSW 9 110551164 missense probably damaging 1.00
R0058:Setd2 UTSW 9 110594426 missense probably damaging 0.98
R0058:Setd2 UTSW 9 110594426 missense probably damaging 0.98
R0167:Setd2 UTSW 9 110573782 missense probably damaging 1.00
R0408:Setd2 UTSW 9 110594242 missense probably damaging 1.00
R0452:Setd2 UTSW 9 110553100 splice site probably null
R0541:Setd2 UTSW 9 110573673 missense probably damaging 1.00
R0947:Setd2 UTSW 9 110548511 missense possibly damaging 0.87
R1249:Setd2 UTSW 9 110573880 missense probably damaging 0.99
R1294:Setd2 UTSW 9 110549507 missense probably benign 0.00
R1518:Setd2 UTSW 9 110602238 missense probably damaging 0.98
R1585:Setd2 UTSW 9 110551396 missense unknown
R1647:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1649:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1651:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1652:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1673:Setd2 UTSW 9 110604180 missense probably damaging 0.97
R1703:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1706:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1709:Setd2 UTSW 9 110549857 missense probably benign 0.00
R1752:Setd2 UTSW 9 110594605 missense probably damaging 1.00
R1796:Setd2 UTSW 9 110550345 missense probably benign 0.01
R1796:Setd2 UTSW 9 110617816 critical splice acceptor site probably null
R1812:Setd2 UTSW 9 110550102 missense probably damaging 0.99
R1884:Setd2 UTSW 9 110556418 critical splice donor site probably null
R2024:Setd2 UTSW 9 110549133 missense possibly damaging 0.65
R2051:Setd2 UTSW 9 110550890 missense probably benign
R2117:Setd2 UTSW 9 110604144 frame shift probably null
R2120:Setd2 UTSW 9 110549864 missense probably benign 0.12
R2124:Setd2 UTSW 9 110549864 missense probably benign 0.12
R2172:Setd2 UTSW 9 110549844 missense probably benign 0.10
R2179:Setd2 UTSW 9 110594688 nonsense probably null
R2262:Setd2 UTSW 9 110561243 intron probably benign
R2411:Setd2 UTSW 9 110550429 missense possibly damaging 0.46
R2413:Setd2 UTSW 9 110547504 missense probably damaging 1.00
R2419:Setd2 UTSW 9 110548997 missense possibly damaging 0.48
R2424:Setd2 UTSW 9 110617522 missense probably benign 0.37
R3757:Setd2 UTSW 9 110573685 missense probably damaging 0.99
R3765:Setd2 UTSW 9 110594246 missense probably damaging 1.00
R3796:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3797:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3799:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3899:Setd2 UTSW 9 110592518 missense probably damaging 1.00
R3900:Setd2 UTSW 9 110592518 missense probably damaging 1.00
R3913:Setd2 UTSW 9 110551046 missense probably damaging 0.99
R4010:Setd2 UTSW 9 110599195 missense probably null 1.00
R4580:Setd2 UTSW 9 110574243 missense probably benign 0.06
R4614:Setd2 UTSW 9 110569813 critical splice donor site probably null
R4651:Setd2 UTSW 9 110594132 missense possibly damaging 0.53
R4652:Setd2 UTSW 9 110594132 missense possibly damaging 0.53
R4855:Setd2 UTSW 9 110571954 missense probably benign 0.02
R4970:Setd2 UTSW 9 110548158 missense probably benign 0.28
R5112:Setd2 UTSW 9 110548158 missense probably benign 0.28
R5140:Setd2 UTSW 9 110551129 missense probably benign 0.00
R5202:Setd2 UTSW 9 110551230 missense probably damaging 1.00
R5290:Setd2 UTSW 9 110617831 missense probably damaging 1.00
R5560:Setd2 UTSW 9 110549839 nonsense probably null
R5604:Setd2 UTSW 9 110604216 missense probably damaging 0.99
R5678:Setd2 UTSW 9 110602186 missense probably damaging 0.99
R5708:Setd2 UTSW 9 110548823 missense possibly damaging 0.59
R5763:Setd2 UTSW 9 110556275 splice site probably null
R5814:Setd2 UTSW 9 110567758 nonsense probably null
R5924:Setd2 UTSW 9 110574044 missense probably benign 0.23
R6244:Setd2 UTSW 9 110548665 missense probably damaging 1.00
R6313:Setd2 UTSW 9 110556366 missense unknown
R6431:Setd2 UTSW 9 110550385 missense possibly damaging 0.65
R6526:Setd2 UTSW 9 110532717 missense probably benign 0.33
R6579:Setd2 UTSW 9 110549778 missense possibly damaging 0.87
R6996:Setd2 UTSW 9 110550572 missense probably damaging 0.99
R7012:Setd2 UTSW 9 110547683 missense probably damaging 0.97
R7105:Setd2 UTSW 9 110548260 missense probably damaging 1.00
R7134:Setd2 UTSW 9 110548797 missense possibly damaging 0.87
R7222:Setd2 UTSW 9 110551462 missense
R7359:Setd2 UTSW 9 110562944 missense
R7492:Setd2 UTSW 9 110594632 missense
R7643:Setd2 UTSW 9 110567840 splice site probably null
R7869:Setd2 UTSW 9 110550014 nonsense probably null
R7903:Setd2 UTSW 9 110617837 missense
R8004:Setd2 UTSW 9 110592545 missense
R8017:Setd2 UTSW 9 110602187 missense
R8019:Setd2 UTSW 9 110602187 missense
R8366:Setd2 UTSW 9 110548748 missense probably damaging 1.00
R8460:Setd2 UTSW 9 110594270 missense
R8498:Setd2 UTSW 9 110549921 missense probably damaging 0.99
R8725:Setd2 UTSW 9 110573844 missense
R8870:Setd2 UTSW 9 110594253 missense
R8878:Setd2 UTSW 9 110592399 missense probably benign
RF009:Setd2 UTSW 9 110550711 missense probably damaging 1.00
Z1176:Setd2 UTSW 9 110532726 missense possibly damaging 0.85
Z1176:Setd2 UTSW 9 110547275 missense probably damaging 0.99
Z1176:Setd2 UTSW 9 110547579 missense probably damaging 0.97
Z1177:Setd2 UTSW 9 110547476 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATCTCATTGGCTTCCTAGG -3'
(R):5'- CACAGGAGAAACCGAGCTTTC -3'

Sequencing Primer
(F):5'- ATTGTTGGCCTAGACAGCAGC -3'
(R):5'- GGAGAAACCGAGCTTTCAAAGTCTC -3'
Posted On2016-06-15