Incidental Mutation 'R5123:Zfp280b'
ID393405
Institutional Source Beutler Lab
Gene Symbol Zfp280b
Ensembl Gene ENSMUSG00000049764
Gene Namezinc finger protein 280B
SynonymsSuhw2, D10Jhu82e
MMRRC Submission 042711-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R5123 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76032650-76043234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76039349 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 354 (D354G)
Ref Sequence ENSEMBL: ENSMUSP00000056340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061617] [ENSMUST00000218627]
Predicted Effect probably benign
Transcript: ENSMUST00000061617
AA Change: D354G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000056340
Gene: ENSMUSG00000049764
AA Change: D354G

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 29 37 N/A INTRINSIC
Pfam:DUF4195 53 227 1.3e-38 PFAM
ZnF_C2H2 297 318 3.65e1 SMART
ZnF_C2H2 334 357 9.46e0 SMART
ZnF_C2H2 364 387 8.22e-2 SMART
ZnF_C2H2 394 417 4.23e0 SMART
ZnF_C2H2 423 445 1.72e1 SMART
ZnF_C2H2 451 474 2.12e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218627
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that upregulates expression of MDM2, which negatively regulates p53 expression. This gene is highly expressed in prostate cancer cells, which leads to a reduction in p53 levels and an increase in growth of the cancer cells. Several transcript variants have been found for this gene, but only one of them is protein-coding. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,384,460 G542D possibly damaging Het
Adh6b A G 3: 138,357,689 Y343C probably damaging Het
Adsl T A 15: 80,952,294 probably null Het
Apob T A 12: 8,007,630 probably null Het
Atp6ap1l T A 13: 90,898,898 probably benign Het
Cacnb3 A G 15: 98,639,869 D74G probably damaging Het
Clca3a2 T A 3: 144,806,343 D544V probably damaging Het
Col3a1 G A 1: 45,333,596 probably benign Het
D7Ertd443e A G 7: 134,349,668 probably null Het
Dscam T C 16: 96,772,437 D775G probably damaging Het
Eif2b3 T A 4: 117,022,211 M16K probably damaging Het
Eml5 T C 12: 98,874,512 Y281C probably damaging Het
Epha2 T A 4: 141,308,865 L204Q possibly damaging Het
Filip1l A C 16: 57,570,662 I538L possibly damaging Het
Gcnt2 T A 13: 40,918,355 V158D probably damaging Het
Gnaq A G 19: 16,332,085 N162S probably benign Het
Haus5 A T 7: 30,654,226 N575K probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Igsf5 A G 16: 96,373,079 D103G probably damaging Het
Myo10 A G 15: 25,726,483 D297G possibly damaging Het
Net1 C T 13: 3,886,623 R314H probably damaging Het
Olfr1273-ps C A 2: 90,296,168 R231L probably benign Het
Olfr1301 T A 2: 111,754,552 V101D probably damaging Het
Pcsk4 C A 10: 80,322,145 Q586H probably null Het
Pramef6 A T 4: 143,897,136 M156K probably benign Het
Prss1 A G 6: 41,463,197 D156G possibly damaging Het
Rnf133 A T 6: 23,649,260 N266K probably damaging Het
Setd2 G T 9: 110,617,527 A2482S possibly damaging Het
Sgo2a A T 1: 58,016,567 S637C probably damaging Het
Slc2a5 C A 4: 150,139,805 S290* probably null Het
Spata6 T G 4: 111,768,795 H120Q possibly damaging Het
Stk11 G A 10: 80,127,941 V194I probably damaging Het
Tkt T C 14: 30,565,646 V199A probably benign Het
Traf3 G A 12: 111,243,518 V183M possibly damaging Het
Trappc11 T C 8: 47,513,402 Y483C probably damaging Het
Trappc9 T C 15: 72,913,366 probably benign Het
Trim59 T C 3: 69,037,734 H91R probably benign Het
Ttc21a A G 9: 119,952,212 S484G probably benign Het
Usp13 A T 3: 32,915,798 H691L probably benign Het
Vmn1r238 T C 18: 3,123,243 Y57C probably benign Het
Vmn2r111 T A 17: 22,571,143 Q294L possibly damaging Het
Vmn2r17 A G 5: 109,427,908 D215G possibly damaging Het
Wdr66 A G 5: 123,273,633 probably benign Het
Zfp607a A G 7: 27,879,098 H531R probably damaging Het
Zfp74 A T 7: 29,934,733 C517S probably damaging Het
Other mutations in Zfp280b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Zfp280b APN 10 76039663 missense probably damaging 0.99
IGL02016:Zfp280b APN 10 76039111 missense possibly damaging 0.68
IGL02245:Zfp280b APN 10 76039363 missense probably benign
IGL03233:Zfp280b APN 10 76039769 missense probably damaging 1.00
R0864:Zfp280b UTSW 10 76038305 missense probably benign 0.00
R1501:Zfp280b UTSW 10 76039769 missense probably damaging 1.00
R1643:Zfp280b UTSW 10 76039610 missense probably damaging 1.00
R2004:Zfp280b UTSW 10 76038536 missense probably benign 0.00
R2024:Zfp280b UTSW 10 76038494 missense probably damaging 1.00
R2025:Zfp280b UTSW 10 76038494 missense probably damaging 1.00
R2027:Zfp280b UTSW 10 76038494 missense probably damaging 1.00
R2064:Zfp280b UTSW 10 76039183 missense probably damaging 1.00
R3729:Zfp280b UTSW 10 76039102 missense probably benign 0.33
R4634:Zfp280b UTSW 10 76038829 missense probably benign 0.00
R4812:Zfp280b UTSW 10 76039090 missense probably benign 0.24
R4968:Zfp280b UTSW 10 76039354 missense probably damaging 1.00
R5007:Zfp280b UTSW 10 76039214 missense probably damaging 1.00
R5503:Zfp280b UTSW 10 76039462 splice site probably null
R5552:Zfp280b UTSW 10 76039663 nonsense probably null
R6954:Zfp280b UTSW 10 76039688 missense probably benign 0.36
R7299:Zfp280b UTSW 10 76038703 missense probably damaging 0.98
R7301:Zfp280b UTSW 10 76038703 missense probably damaging 0.98
R7485:Zfp280b UTSW 10 76039241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAATGCCCCAGCTGCTTG -3'
(R):5'- ATGGCATCCCAGTTTTGAAGATC -3'

Sequencing Primer
(F):5'- TCATTTGGAGCTCGAGAG -3'
(R):5'- ACTTTGTAAAGTGTGTCTCCACG -3'
Posted On2016-06-15