Mutagenetix > Incidental Mutations

Incidental Mutation 'R5123:Filip1l'

393420

Institutional Source

Beutler Lab

Gene Symbol

Filip1l

Ensembl Gene

ENSMUSG00000043336

Gene Name

filamin A interacting protein 1-like

Synonyms

MMRRC Submission

042711-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5123 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57353093-57573126 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 57570662 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 538 (I538L)

Ref Sequence

ENSEMBL: ENSMUSP00000124179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114371] [ENSMUST00000159414] [ENSMUST00000159816] [ENSMUST00000232413]

Predicted Effect

probably benign
Transcript: ENSMUST00000114371

SMART Domains

Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748

Domain	Start	End	E-Value	Type
low complexity region	13	29	N/A	INTRINSIC
Pfam:CMS1	42	266	7.9e-35	PFAM
Pfam:DEAD	127	234	4e-7	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159414
AA Change: I300L

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000124069
Gene: ENSMUSG00000043336
AA Change: I300L

Domain	Start	End	E-Value	Type
coiled coil region	4	345	N/A	INTRINSIC
coiled coil region	371	542	N/A	INTRINSIC
low complexity region	589	602	N/A	INTRINSIC
low complexity region	868	879	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159816
AA Change: I538L

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000124179
Gene: ENSMUSG00000043336
AA Change: I538L

Domain	Start	End	E-Value	Type
Pfam:CortBP2	61	246	1.8e-65	PFAM
low complexity region	271	286	N/A	INTRINSIC
low complexity region	483	495	N/A	INTRINSIC
coiled coil region	609	780	N/A	INTRINSIC
low complexity region	827	840	N/A	INTRINSIC
low complexity region	1106	1117	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231282

Predicted Effect

probably benign
Transcript: ENSMUST00000232413

Meta Mutation Damage Score

0.1750

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

98% (53/54)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	G	A	17: 24,384,460	G542D	possibly damaging	Het
Adh6b	A	G	3: 138,357,689	Y343C	probably damaging	Het
Adsl	T	A	15: 80,952,294		probably null	Het
Apob	T	A	12: 8,007,630		probably null	Het
Atp6ap1l	T	A	13: 90,898,898		probably benign	Het
Cacnb3	A	G	15: 98,639,869	D74G	probably damaging	Het
Clca3a2	T	A	3: 144,806,343	D544V	probably damaging	Het
Col3a1	G	A	1: 45,333,596		probably benign	Het
D7Ertd443e	A	G	7: 134,349,668		probably null	Het
Dscam	T	C	16: 96,772,437	D775G	probably damaging	Het
Eif2b3	T	A	4: 117,022,211	M16K	probably damaging	Het
Eml5	T	C	12: 98,874,512	Y281C	probably damaging	Het
Epha2	T	A	4: 141,308,865	L204Q	possibly damaging	Het
Gcnt2	T	A	13: 40,918,355	V158D	probably damaging	Het
Gnaq	A	G	19: 16,332,085	N162S	probably benign	Het
Haus5	A	T	7: 30,654,226	N575K	probably benign	Het
Hjurp	A	T	1: 88,275,050	Y71N	possibly damaging	Het
Igsf5	A	G	16: 96,373,079	D103G	probably damaging	Het
Myo10	A	G	15: 25,726,483	D297G	possibly damaging	Het
Net1	C	T	13: 3,886,623	R314H	probably damaging	Het
Olfr1273-ps	C	A	2: 90,296,168	R231L	probably benign	Het
Olfr1301	T	A	2: 111,754,552	V101D	probably damaging	Het
Pcsk4	C	A	10: 80,322,145	Q586H	probably null	Het
Pramef6	A	T	4: 143,897,136	M156K	probably benign	Het
Prss1	A	G	6: 41,463,197	D156G	possibly damaging	Het
Rnf133	A	T	6: 23,649,260	N266K	probably damaging	Het
Setd2	G	T	9: 110,617,527	A2482S	possibly damaging	Het
Sgo2a	A	T	1: 58,016,567	S637C	probably damaging	Het
Slc2a5	C	A	4: 150,139,805	S290*	probably null	Het
Spata6	T	G	4: 111,768,795	H120Q	possibly damaging	Het
Stk11	G	A	10: 80,127,941	V194I	probably damaging	Het
Tkt	T	C	14: 30,565,646	V199A	probably benign	Het
Traf3	G	A	12: 111,243,518	V183M	possibly damaging	Het
Trappc11	T	C	8: 47,513,402	Y483C	probably damaging	Het
Trappc9	T	C	15: 72,913,366		probably benign	Het
Trim59	T	C	3: 69,037,734	H91R	probably benign	Het
Ttc21a	A	G	9: 119,952,212	S484G	probably benign	Het
Usp13	A	T	3: 32,915,798	H691L	probably benign	Het
Vmn1r238	T	C	18: 3,123,243	Y57C	probably benign	Het
Vmn2r111	T	A	17: 22,571,143	Q294L	possibly damaging	Het
Vmn2r17	A	G	5: 109,427,908	D215G	possibly damaging	Het
Wdr66	A	G	5: 123,273,633		probably benign	Het
Zfp280b	A	G	10: 76,039,349	D354G	probably benign	Het
Zfp607a	A	G	7: 27,879,098	H531R	probably damaging	Het
Zfp74	A	T	7: 29,934,733	C517S	probably damaging	Het

Other mutations in Filip1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01294:Filip1l	APN	16	57572348	nonsense	probably null
IGL01393:Filip1l	APN	16	57572223	missense	probably damaging	1.00
IGL01886:Filip1l	APN	16	57571250	missense	possibly damaging	0.47
IGL02336:Filip1l	APN	16	57571733	splice site	probably null
IGL02503:Filip1l	APN	16	57571575	missense	probably benign	0.00
IGL02608:Filip1l	APN	16	57572106	missense	probably benign	0.05
IGL02681:Filip1l	APN	16	57571779	missense	probably benign	0.10
IGL02687:Filip1l	APN	16	57571127	missense	probably benign	0.30
IGL02982:Filip1l	APN	16	57572232	missense	probably damaging	1.00
IGL03062:Filip1l	APN	16	57506804	missense	probably damaging	1.00
R1027:Filip1l	UTSW	16	57569688	missense	probably benign
R1347:Filip1l	UTSW	16	57570987	missense	probably damaging	1.00
R1347:Filip1l	UTSW	16	57570987	missense	probably damaging	1.00
R1384:Filip1l	UTSW	16	57571289	missense	possibly damaging	0.61
R1655:Filip1l	UTSW	16	57571851	missense	probably damaging	1.00
R1764:Filip1l	UTSW	16	57570038	missense	probably damaging	1.00
R1809:Filip1l	UTSW	16	57506660	missense	probably benign
R1983:Filip1l	UTSW	16	57571274	missense	probably damaging	0.98
R2504:Filip1l	UTSW	16	57570662	missense	possibly damaging	0.76
R2504:Filip1l	UTSW	16	57571047	missense	probably damaging	0.97
R3117:Filip1l	UTSW	16	57506732	missense	probably benign	0.07
R3844:Filip1l	UTSW	16	57572427	missense	probably benign	0.15
R3871:Filip1l	UTSW	16	57513286	missense	probably damaging	0.97
R4231:Filip1l	UTSW	16	57506768	missense	probably benign
R4391:Filip1l	UTSW	16	57570792	nonsense	probably null
R4700:Filip1l	UTSW	16	57570695	missense	probably benign	0.00
R4999:Filip1l	UTSW	16	57570415	missense	probably benign	0.01
R5002:Filip1l	UTSW	16	57571103	missense	probably benign	0.01
R5294:Filip1l	UTSW	16	57570036	missense	possibly damaging	0.59
R5429:Filip1l	UTSW	16	57570255	missense	probably damaging	0.99
R5811:Filip1l	UTSW	16	57570294	missense	probably damaging	1.00
R6220:Filip1l	UTSW	16	57569989	missense	probably benign	0.31
R6452:Filip1l	UTSW	16	57506800	missense	possibly damaging	0.82
R6678:Filip1l	UTSW	16	57569970	missense	probably benign	0.00
R6700:Filip1l	UTSW	16	57571248	missense	possibly damaging	0.86
R7260:Filip1l	UTSW	16	57570924	missense	probably damaging	1.00
R7327:Filip1l	UTSW	16	57570937	missense	probably damaging	1.00
R7578:Filip1l	UTSW	16	57513282	missense	probably damaging	0.99
R7691:Filip1l	UTSW	16	57572433	missense	probably benign	0.00
R7950:Filip1l	UTSW	16	57569711	missense	probably damaging	1.00
R8288:Filip1l	UTSW	16	57570554	missense	probably damaging	1.00
R8334:Filip1l	UTSW	16	57570147	missense	probably benign	0.18
R8392:Filip1l	UTSW	16	57571353	missense	probably damaging	1.00
RF019:Filip1l	UTSW	16	57570641	missense	probably benign	0.07
Z1088:Filip1l	UTSW	16	57513405	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGGAGAGTTTAAATGCCAG -3'
(R):5'- TTGCTTCCAGTGACTGAAGCC -3'

Sequencing Primer
(F):5'- CTAGAAGCCATTGAAAGTCGGC -3'
(R):5'- CAGTGACTGAAGCCTGTTTTTC -3'

Posted On

2016-06-15