Incidental Mutation 'R5123:Igsf5'
ID393421
Institutional Source Beutler Lab
Gene Symbol Igsf5
Ensembl Gene ENSMUSG00000000159
Gene Nameimmunoglobulin superfamily, member 5
SynonymsIgsf5, Jam4
MMRRC Submission 042711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R5123 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location96361668-96525580 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96373079 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 103 (D103G)
Ref Sequence ENSEMBL: ENSMUSP00000109425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000163] [ENSMUST00000081093] [ENSMUST00000113794] [ENSMUST00000113795]
Predicted Effect probably damaging
Transcript: ENSMUST00000000163
AA Change: D103G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000163
Gene: ENSMUSG00000000159
AA Change: D103G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 127 9.63e-6 SMART
IG 134 221 2.64e0 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081093
AA Change: D103G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079874
Gene: ENSMUSG00000000159
AA Change: D103G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113794
AA Change: D103G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109425
Gene: ENSMUSG00000000159
AA Change: D103G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 127 9.63e-6 SMART
IG 134 221 2.64e0 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113795
AA Change: D103G
SMART Domains Protein: ENSMUSP00000109426
Gene: ENSMUSG00000000159
AA Change: D103G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Meta Mutation Damage Score 0.4594 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (53/54)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,384,460 G542D possibly damaging Het
Adh6b A G 3: 138,357,689 Y343C probably damaging Het
Adsl T A 15: 80,952,294 probably null Het
Apob T A 12: 8,007,630 probably null Het
Atp6ap1l T A 13: 90,898,898 probably benign Het
Cacnb3 A G 15: 98,639,869 D74G probably damaging Het
Clca3a2 T A 3: 144,806,343 D544V probably damaging Het
Col3a1 G A 1: 45,333,596 probably benign Het
D7Ertd443e A G 7: 134,349,668 probably null Het
Dscam T C 16: 96,772,437 D775G probably damaging Het
Eif2b3 T A 4: 117,022,211 M16K probably damaging Het
Eml5 T C 12: 98,874,512 Y281C probably damaging Het
Epha2 T A 4: 141,308,865 L204Q possibly damaging Het
Filip1l A C 16: 57,570,662 I538L possibly damaging Het
Gcnt2 T A 13: 40,918,355 V158D probably damaging Het
Gnaq A G 19: 16,332,085 N162S probably benign Het
Haus5 A T 7: 30,654,226 N575K probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Myo10 A G 15: 25,726,483 D297G possibly damaging Het
Net1 C T 13: 3,886,623 R314H probably damaging Het
Olfr1273-ps C A 2: 90,296,168 R231L probably benign Het
Olfr1301 T A 2: 111,754,552 V101D probably damaging Het
Pcsk4 C A 10: 80,322,145 Q586H probably null Het
Pramef6 A T 4: 143,897,136 M156K probably benign Het
Prss1 A G 6: 41,463,197 D156G possibly damaging Het
Rnf133 A T 6: 23,649,260 N266K probably damaging Het
Setd2 G T 9: 110,617,527 A2482S possibly damaging Het
Sgo2a A T 1: 58,016,567 S637C probably damaging Het
Slc2a5 C A 4: 150,139,805 S290* probably null Het
Spata6 T G 4: 111,768,795 H120Q possibly damaging Het
Stk11 G A 10: 80,127,941 V194I probably damaging Het
Tkt T C 14: 30,565,646 V199A probably benign Het
Traf3 G A 12: 111,243,518 V183M possibly damaging Het
Trappc11 T C 8: 47,513,402 Y483C probably damaging Het
Trappc9 T C 15: 72,913,366 probably benign Het
Trim59 T C 3: 69,037,734 H91R probably benign Het
Ttc21a A G 9: 119,952,212 S484G probably benign Het
Usp13 A T 3: 32,915,798 H691L probably benign Het
Vmn1r238 T C 18: 3,123,243 Y57C probably benign Het
Vmn2r111 T A 17: 22,571,143 Q294L possibly damaging Het
Vmn2r17 A G 5: 109,427,908 D215G possibly damaging Het
Wdr66 A G 5: 123,273,633 probably benign Het
Zfp280b A G 10: 76,039,349 D354G probably benign Het
Zfp607a A G 7: 27,879,098 H531R probably damaging Het
Zfp74 A T 7: 29,934,733 C517S probably damaging Het
Other mutations in Igsf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Igsf5 APN 16 96391020 missense possibly damaging 0.72
IGL01335:Igsf5 APN 16 96373153 splice site probably benign
IGL02576:Igsf5 APN 16 96386581 missense probably benign 0.23
IGL02721:Igsf5 APN 16 96391022 missense probably damaging 0.98
IGL03289:Igsf5 APN 16 96525432 missense possibly damaging 0.94
R0630:Igsf5 UTSW 16 96372823 splice site probably benign
R1858:Igsf5 UTSW 16 96386629 splice site probably null
R1961:Igsf5 UTSW 16 96378351 missense probably damaging 1.00
R2508:Igsf5 UTSW 16 96364047 missense probably benign 0.01
R4491:Igsf5 UTSW 16 96364081 missense probably benign 0.02
R5262:Igsf5 UTSW 16 96391037 nonsense probably null
R5384:Igsf5 UTSW 16 96391026 missense probably benign 0.21
R5558:Igsf5 UTSW 16 96386531 missense possibly damaging 0.95
R5950:Igsf5 UTSW 16 96372872 missense probably benign 0.07
R5957:Igsf5 UTSW 16 96364049 missense probably benign 0.10
R6199:Igsf5 UTSW 16 96421739 missense possibly damaging 0.66
R6298:Igsf5 UTSW 16 96396448 missense possibly damaging 0.93
R7164:Igsf5 UTSW 16 96372848 missense possibly damaging 0.85
R7197:Igsf5 UTSW 16 96403346 missense probably damaging 1.00
R8213:Igsf5 UTSW 16 96372988 missense probably damaging 1.00
R8353:Igsf5 UTSW 16 96421796 missense probably benign 0.00
R8453:Igsf5 UTSW 16 96421796 missense probably benign 0.00
Z1176:Igsf5 UTSW 16 96391023 missense probably damaging 1.00
Z1177:Igsf5 UTSW 16 96378333 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACTTCAACTGCACCGTGACTC -3'
(R):5'- GAAGGAACCCAGTTGGCAAC -3'

Sequencing Primer
(F):5'- TCACGGCTGGAAGCTTCTCATG -3'
(R):5'- CAAAGCAGTCTTCAGTTCGG -3'
Posted On2016-06-15