Mutagenetix > Incidental Mutations

Incidental Mutation 'R5123:Vmn2r111'

393423

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

042711-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R5123 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 22571143 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 294 (Q294L)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092491
AA Change: Q294L

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: Q294L

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

98% (53/54)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	G	A	17: 24,384,460	G542D	possibly damaging	Het
Adh6b	A	G	3: 138,357,689	Y343C	probably damaging	Het
Adsl	T	A	15: 80,952,294		probably null	Het
Apob	T	A	12: 8,007,630		probably null	Het
Atp6ap1l	T	A	13: 90,898,898		probably benign	Het
Cacnb3	A	G	15: 98,639,869	D74G	probably damaging	Het
Clca3a2	T	A	3: 144,806,343	D544V	probably damaging	Het
Col3a1	G	A	1: 45,333,596		probably benign	Het
D7Ertd443e	A	G	7: 134,349,668		probably null	Het
Dscam	T	C	16: 96,772,437	D775G	probably damaging	Het
Eif2b3	T	A	4: 117,022,211	M16K	probably damaging	Het
Eml5	T	C	12: 98,874,512	Y281C	probably damaging	Het
Epha2	T	A	4: 141,308,865	L204Q	possibly damaging	Het
Filip1l	A	C	16: 57,570,662	I538L	possibly damaging	Het
Gcnt2	T	A	13: 40,918,355	V158D	probably damaging	Het
Gnaq	A	G	19: 16,332,085	N162S	probably benign	Het
Haus5	A	T	7: 30,654,226	N575K	probably benign	Het
Hjurp	A	T	1: 88,275,050	Y71N	possibly damaging	Het
Igsf5	A	G	16: 96,373,079	D103G	probably damaging	Het
Myo10	A	G	15: 25,726,483	D297G	possibly damaging	Het
Net1	C	T	13: 3,886,623	R314H	probably damaging	Het
Olfr1273-ps	C	A	2: 90,296,168	R231L	probably benign	Het
Olfr1301	T	A	2: 111,754,552	V101D	probably damaging	Het
Pcsk4	C	A	10: 80,322,145	Q586H	probably null	Het
Pramef6	A	T	4: 143,897,136	M156K	probably benign	Het
Prss1	A	G	6: 41,463,197	D156G	possibly damaging	Het
Rnf133	A	T	6: 23,649,260	N266K	probably damaging	Het
Setd2	G	T	9: 110,617,527	A2482S	possibly damaging	Het
Sgo2a	A	T	1: 58,016,567	S637C	probably damaging	Het
Slc2a5	C	A	4: 150,139,805	S290*	probably null	Het
Spata6	T	G	4: 111,768,795	H120Q	possibly damaging	Het
Stk11	G	A	10: 80,127,941	V194I	probably damaging	Het
Tkt	T	C	14: 30,565,646	V199A	probably benign	Het
Traf3	G	A	12: 111,243,518	V183M	possibly damaging	Het
Trappc11	T	C	8: 47,513,402	Y483C	probably damaging	Het
Trappc9	T	C	15: 72,913,366		probably benign	Het
Trim59	T	C	3: 69,037,734	H91R	probably benign	Het
Ttc21a	A	G	9: 119,952,212	S484G	probably benign	Het
Usp13	A	T	3: 32,915,798	H691L	probably benign	Het
Vmn1r238	T	C	18: 3,123,243	Y57C	probably benign	Het
Vmn2r17	A	G	5: 109,427,908	D215G	possibly damaging	Het
Wdr66	A	G	5: 123,273,633		probably benign	Het
Zfp280b	A	G	10: 76,039,349	D354G	probably benign	Het
Zfp607a	A	G	7: 27,879,098	H531R	probably damaging	Het
Zfp74	A	T	7: 29,934,733	C517S	probably damaging	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GTCTTACATTTAGATGCTGAGACCTC -3'
(R):5'- ACACAGTGTGCTTTGCCTTTG -3'

Sequencing Primer
(F):5'- TGCTGAGACCTCACAGTTAAAGTG -3'
(R):5'- GTCAACATGATTCCAGTCAACATG -3'

Posted On

2016-06-15