Incidental Mutation 'R5123:Gnaq'
ID393426
Institutional Source Beutler Lab
Gene Symbol Gnaq
Ensembl Gene ENSMUSG00000024639
Gene Nameguanine nucleotide binding protein, alpha q polypeptide
SynonymsGqI, Galphaq, Dsk10, G alpha q, 6230401I02Rik, Dsk1, Gq, 1110005L02Rik
MMRRC Submission 042711-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5123 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location16132831-16387463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16332085 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 162 (N162S)
Ref Sequence ENSEMBL: ENSMUSP00000025541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025541]
PDB Structure
Crystal Structure of G Protein-Coupled Receptor Kinase 2 in Complex with Galpha-q and Gbetagamma Subunits [X-RAY DIFFRACTION]
Crystal Structure of p63RhoGEF complex with Galpha-q and RhoA [X-RAY DIFFRACTION]
Structure of heterotrimeric G protein Galpha-q beta gamma in complex with an inhibitor YM-254890 [X-RAY DIFFRACTION]
Crystal structure of activated G alpha Q bound to its effector phospholipase C beta 3 [X-RAY DIFFRACTION]
Structure of human regulator of G protein signaling 2 (RGS2) in complex with murine Galpha-q(R183C) [X-RAY DIFFRACTION]
Structure of human regulator of G protein signaling 2 (RGS2) in complex with murine Galpha-q(R183C) [X-RAY DIFFRACTION]
Crystal structure of Galphaq in complex with full-length human PLCbeta3 [X-RAY DIFFRACTION]
Structure of a fragment of human phospholipase C-beta3 delta472-559, in complex with Galphaq [X-RAY DIFFRACTION]
Structure of a fragment of human phospholipase C-beta3 delta472-569, bound to IP3 and in complex with Galphaq [X-RAY DIFFRACTION]
Structure of a fragment of human phospholipase C-beta3 delta472-581, bound to IP3 and in complex with Galphaq [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025541
AA Change: N162S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025541
Gene: ENSMUSG00000024639
AA Change: N162S

DomainStartEndE-ValueType
G_alpha 19 358 1.24e-216 SMART
Meta Mutation Damage Score 0.0951 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a guanine nucleotide-binding protein. The encoded protein, an alpha subunit in the Gq class, couples a seven-transmembrane domain receptor to activation of phospolipase C-beta. Mutations at this locus have been associated with problems in platelet activation and aggregation. A related pseudogene exists on chromosome 2.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mutant mice exhibit pigmentation anomalies affecting the ears, tail and footpads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,384,460 G542D possibly damaging Het
Adh6b A G 3: 138,357,689 Y343C probably damaging Het
Adsl T A 15: 80,952,294 probably null Het
Apob T A 12: 8,007,630 probably null Het
Atp6ap1l T A 13: 90,898,898 probably benign Het
Cacnb3 A G 15: 98,639,869 D74G probably damaging Het
Clca3a2 T A 3: 144,806,343 D544V probably damaging Het
Col3a1 G A 1: 45,333,596 probably benign Het
D7Ertd443e A G 7: 134,349,668 probably null Het
Dscam T C 16: 96,772,437 D775G probably damaging Het
Eif2b3 T A 4: 117,022,211 M16K probably damaging Het
Eml5 T C 12: 98,874,512 Y281C probably damaging Het
Epha2 T A 4: 141,308,865 L204Q possibly damaging Het
Filip1l A C 16: 57,570,662 I538L possibly damaging Het
Gcnt2 T A 13: 40,918,355 V158D probably damaging Het
Haus5 A T 7: 30,654,226 N575K probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Igsf5 A G 16: 96,373,079 D103G probably damaging Het
Myo10 A G 15: 25,726,483 D297G possibly damaging Het
Net1 C T 13: 3,886,623 R314H probably damaging Het
Olfr1273-ps C A 2: 90,296,168 R231L probably benign Het
Olfr1301 T A 2: 111,754,552 V101D probably damaging Het
Pcsk4 C A 10: 80,322,145 Q586H probably null Het
Pramef6 A T 4: 143,897,136 M156K probably benign Het
Prss1 A G 6: 41,463,197 D156G possibly damaging Het
Rnf133 A T 6: 23,649,260 N266K probably damaging Het
Setd2 G T 9: 110,617,527 A2482S possibly damaging Het
Sgo2a A T 1: 58,016,567 S637C probably damaging Het
Slc2a5 C A 4: 150,139,805 S290* probably null Het
Spata6 T G 4: 111,768,795 H120Q possibly damaging Het
Stk11 G A 10: 80,127,941 V194I probably damaging Het
Tkt T C 14: 30,565,646 V199A probably benign Het
Traf3 G A 12: 111,243,518 V183M possibly damaging Het
Trappc11 T C 8: 47,513,402 Y483C probably damaging Het
Trappc9 T C 15: 72,913,366 probably benign Het
Trim59 T C 3: 69,037,734 H91R probably benign Het
Ttc21a A G 9: 119,952,212 S484G probably benign Het
Usp13 A T 3: 32,915,798 H691L probably benign Het
Vmn1r238 T C 18: 3,123,243 Y57C probably benign Het
Vmn2r111 T A 17: 22,571,143 Q294L possibly damaging Het
Vmn2r17 A G 5: 109,427,908 D215G possibly damaging Het
Wdr66 A G 5: 123,273,633 probably benign Het
Zfp280b A G 10: 76,039,349 D354G probably benign Het
Zfp607a A G 7: 27,879,098 H531R probably damaging Het
Zfp74 A T 7: 29,934,733 C517S probably damaging Het
Other mutations in Gnaq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01967:Gnaq APN 19 16378160 missense probably damaging 1.00
IGL02297:Gnaq APN 19 16378251 missense probably damaging 1.00
IGL02400:Gnaq APN 19 16316128 missense probably damaging 1.00
IGL03073:Gnaq APN 19 16316106 missense probably benign 0.18
R0542:Gnaq UTSW 19 16219618 missense probably damaging 0.99
R0800:Gnaq UTSW 19 16335064 missense probably damaging 1.00
R1368:Gnaq UTSW 19 16378287 missense probably benign
R1609:Gnaq UTSW 19 16383254 missense possibly damaging 0.86
R4569:Gnaq UTSW 19 16335006 missense probably damaging 1.00
R5360:Gnaq UTSW 19 16133426 missense probably benign 0.01
R6384:Gnaq UTSW 19 16316013 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCAGCTGCTGAGGAAATGGG -3'
(R):5'- CATGGTGGTTCCTGTCTAATATACAG -3'

Sequencing Primer
(F):5'- CTGCTGAGGAAATGGGAATGTG -3'
(R):5'- TCGAACTCTAAGCACGTC -3'
Posted On2016-06-15