Incidental Mutation 'R5124:Olfr1218'
ID393432
Institutional Source Beutler Lab
Gene Symbol Olfr1218
Ensembl Gene ENSMUSG00000075105
Gene Nameolfactory receptor 1218
SynonymsGA_x6K02T2Q125-50536041-50535106, MOR233-12
MMRRC Submission 042712-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5124 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89052296-89061187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89055087 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 113 (V113D)
Ref Sequence ENSEMBL: ENSMUSP00000149671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099798] [ENSMUST00000213609] [ENSMUST00000215048] [ENSMUST00000215054]
Predicted Effect probably damaging
Transcript: ENSMUST00000099798
AA Change: V113D

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097386
Gene: ENSMUSG00000075105
AA Change: V113D

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.4e-45 PFAM
Pfam:7tm_1 39 286 2.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213609
AA Change: V113D

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000215048
AA Change: V113D

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000215054
AA Change: V113D

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.4279 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adpgk A G 9: 59,315,278 D496G possibly damaging Het
Agbl4 A G 4: 111,656,328 M424V probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Bpifa3 C T 2: 154,138,137 Q230* probably null Het
Cog4 G T 8: 110,847,193 R48L probably damaging Het
Cop1 A G 1: 159,278,112 Y33C probably damaging Het
Cyp26a1 A T 19: 37,701,217 I454L probably benign Het
Ddr1 T C 17: 35,683,597 H762R probably damaging Het
Dnajc2 A T 5: 21,763,484 S328T probably benign Het
Dppa2 G T 16: 48,311,623 V28F probably damaging Het
Dusp15 T A 2: 152,951,355 M1L possibly damaging Het
Eml5 G A 12: 98,792,042 T1875M probably damaging Het
Fam186a A G 15: 99,943,096 S1756P possibly damaging Het
Gm436 A T 4: 144,674,719 I65N probably damaging Het
Gm5431 T A 11: 48,889,039 Q630L probably benign Het
Gm9733 T A 3: 15,320,579 R88* probably null Het
H6pd A G 4: 149,982,055 S625P possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnj6 G T 16: 94,832,659 P180T probably damaging Het
Lpin3 T A 2: 160,897,061 M263K probably benign Het
Lrp2 A T 2: 69,501,490 D1640E probably damaging Het
Lypd2 C T 15: 74,732,498 A74T probably benign Het
Map4k1 T C 7: 28,988,832 L223P probably damaging Het
Myh7 A T 14: 54,985,742 Y715* probably null Het
Myo9b T C 8: 71,355,839 S1697P probably damaging Het
Neb T C 2: 52,281,498 E1661G probably damaging Het
Nek8 A T 11: 78,172,939 M80K probably damaging Het
Nup188 T A 2: 30,330,935 L979Q probably damaging Het
P4htm T A 9: 108,581,942 S264C possibly damaging Het
Pcdha8 A G 18: 36,993,715 T417A probably benign Het
Pclo T C 5: 14,677,392 probably benign Het
Prox1 T A 1: 190,161,279 N323I possibly damaging Het
Prune2 A T 19: 17,199,910 R222S probably damaging Het
Psmd2 C A 16: 20,652,698 R100S possibly damaging Het
Qrich2 A T 11: 116,446,773 M1963K probably damaging Het
Rbm39 C T 2: 156,159,162 G324D probably damaging Het
Rhobtb1 A T 10: 69,269,901 probably null Het
Rhov G T 2: 119,271,087 P13T unknown Het
Sec14l3 A G 11: 4,075,209 D273G possibly damaging Het
Slco2a1 T A 9: 103,050,166 I86N probably damaging Het
Smg1 A T 7: 118,213,012 S19T probably benign Het
Stk32a T C 18: 43,305,017 S194P probably benign Het
Syna G A 5: 134,559,570 S175L possibly damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmem151b T C 17: 45,547,119 Y67C probably damaging Het
Tshz1 C T 18: 84,015,467 R272Q probably damaging Het
Tti1 A G 2: 158,008,195 S375P probably damaging Het
Vcan T C 13: 89,725,517 K73E probably damaging Het
Vmn1r202 C T 13: 22,501,750 V166I probably benign Het
Vmn2r10 A G 5: 109,006,420 V6A probably benign Het
Zfhx4 A G 3: 5,242,047 D111G probably damaging Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Other mutations in Olfr1218
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Olfr1218 APN 2 89054569 missense probably damaging 1.00
IGL03089:Olfr1218 APN 2 89055013 missense probably benign 0.34
IGL03387:Olfr1218 APN 2 89055113 missense probably damaging 1.00
R0350:Olfr1218 UTSW 2 89055356 missense probably benign 0.10
R0699:Olfr1218 UTSW 2 89055292 missense possibly damaging 0.67
R1609:Olfr1218 UTSW 2 89055344 missense probably benign
R1856:Olfr1218 UTSW 2 89054859 missense possibly damaging 0.95
R1972:Olfr1218 UTSW 2 89054547 missense probably benign 0.05
R2066:Olfr1218 UTSW 2 89054899 missense probably damaging 0.99
R2921:Olfr1218 UTSW 2 89054499 missense probably benign 0.04
R2923:Olfr1218 UTSW 2 89054499 missense probably benign 0.04
R4037:Olfr1218 UTSW 2 89054688 missense probably damaging 0.99
R4585:Olfr1218 UTSW 2 89055154 missense possibly damaging 0.77
R4586:Olfr1218 UTSW 2 89055154 missense possibly damaging 0.77
R5041:Olfr1218 UTSW 2 89054921 nonsense probably null
R5138:Olfr1218 UTSW 2 89054947 missense probably benign 0.00
R5415:Olfr1218 UTSW 2 89054896 missense probably benign 0.00
R5501:Olfr1218 UTSW 2 89054886 nonsense probably null
R5941:Olfr1218 UTSW 2 89054619 missense probably benign
R5991:Olfr1218 UTSW 2 89054782 missense probably benign 0.01
R6396:Olfr1218 UTSW 2 89055297 missense probably benign 0.36
R7047:Olfr1218 UTSW 2 89055146 missense probably damaging 0.98
R8038:Olfr1218 UTSW 2 89054868 missense probably damaging 1.00
R8387:Olfr1218 UTSW 2 89055302 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTTCAGCAATGGAAACAAGTCAC -3'
(R):5'- TCATGTACAGCCCTGCACTG -3'

Sequencing Primer
(F):5'- TGATCAATGACATTGGGTCCAC -3'
(R):5'- TGCACTGCTGGGATCCC -3'
Posted On2016-06-15