Mutagenetix > Incidental Mutations

Incidental Mutation 'R5124:Eml5'

393463

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

042712-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.334) question?

Stock #

R5124 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 98792042 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 1875 (T1875M)

Ref Sequence

ENSEMBL: ENSMUSP00000152709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057000] [ENSMUST00000065716] [ENSMUST00000110104] [ENSMUST00000110105] [ENSMUST00000223282]

AlphaFold

Q8BQM8

Predicted Effect

probably benign
Transcript: ENSMUST00000057000

SMART Domains

Protein: ENSMUSP00000055879
Gene: ENSMUSG00000021012

Domain	Start	End	E-Value	Type
low complexity region	298	306	N/A	INTRINSIC
low complexity region	313	320	N/A	INTRINSIC
ZnF_C3H1	440	463	7.16e-1	SMART
ZnF_C3H1	465	484	5.27e1	SMART
ZnF_C3H1	520	542	5.55e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000065716
AA Change: T1828M

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: T1828M

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110104

SMART Domains

Protein: ENSMUSP00000105731
Gene: ENSMUSG00000021012

Domain	Start	End	E-Value	Type
low complexity region	298	306	N/A	INTRINSIC
low complexity region	313	320	N/A	INTRINSIC
ZnF_C3H1	465	488	7.16e-1	SMART
ZnF_C3H1	490	509	5.27e1	SMART
ZnF_C3H1	545	567	5.55e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110105

SMART Domains

Protein: ENSMUSP00000105732
Gene: ENSMUSG00000021012

Domain	Start	End	E-Value	Type
low complexity region	298	306	N/A	INTRINSIC
low complexity region	313	320	N/A	INTRINSIC
ZnF_C3H1	596	619	7.16e-1	SMART
ZnF_C3H1	621	640	5.27e1	SMART
ZnF_C3H1	676	698	5.55e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220848

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221107

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221902

Predicted Effect

probably benign
Transcript: ENSMUST00000222097

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222717

Predicted Effect

probably damaging
Transcript: ENSMUST00000223282
AA Change: T1875M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

100% (60/60)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adpgk	A	G	9: 59,315,278	D496G	possibly damaging	Het
Agbl4	A	G	4: 111,656,328	M424V	probably benign	Het
Akap10	C	T	11: 61,916,189	A72T	probably damaging	Het
Bpifa3	C	T	2: 154,138,137	Q230*	probably null	Het
Cog4	G	T	8: 110,847,193	R48L	probably damaging	Het
Cop1	A	G	1: 159,278,112	Y33C	probably damaging	Het
Cyp26a1	A	T	19: 37,701,217	I454L	probably benign	Het
Ddr1	T	C	17: 35,683,597	H762R	probably damaging	Het
Dnajc2	A	T	5: 21,763,484	S328T	probably benign	Het
Dppa2	G	T	16: 48,311,623	V28F	probably damaging	Het
Dusp15	T	A	2: 152,951,355	M1L	possibly damaging	Het
Fam186a	A	G	15: 99,943,096	S1756P	possibly damaging	Het
Gm436	A	T	4: 144,674,719	I65N	probably damaging	Het
Gm5431	T	A	11: 48,889,039	Q630L	probably benign	Het
Gm9733	T	A	3: 15,320,579	R88*	probably null	Het
H6pd	A	G	4: 149,982,055	S625P	possibly damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kcnj6	G	T	16: 94,832,659	P180T	probably damaging	Het
Lpin3	T	A	2: 160,897,061	M263K	probably benign	Het
Lrp2	A	T	2: 69,501,490	D1640E	probably damaging	Het
Lypd2	C	T	15: 74,732,498	A74T	probably benign	Het
Map4k1	T	C	7: 28,988,832	L223P	probably damaging	Het
Myh7	A	T	14: 54,985,742	Y715*	probably null	Het
Myo9b	T	C	8: 71,355,839	S1697P	probably damaging	Het
Neb	T	C	2: 52,281,498	E1661G	probably damaging	Het
Nek8	A	T	11: 78,172,939	M80K	probably damaging	Het
Nup188	T	A	2: 30,330,935	L979Q	probably damaging	Het
Olfr1218	A	T	2: 89,055,087	V113D	probably damaging	Het
P4htm	T	A	9: 108,581,942	S264C	possibly damaging	Het
Pcdha8	A	G	18: 36,993,715	T417A	probably benign	Het
Pclo	T	C	5: 14,677,392		probably benign	Het
Prox1	T	A	1: 190,161,279	N323I	possibly damaging	Het
Prune2	A	T	19: 17,199,910	R222S	probably damaging	Het
Psmd2	C	A	16: 20,652,698	R100S	possibly damaging	Het
Qrich2	A	T	11: 116,446,773	M1963K	probably damaging	Het
Rbm39	C	T	2: 156,159,162	G324D	probably damaging	Het
Rhobtb1	A	T	10: 69,269,901		probably null	Het
Rhov	G	T	2: 119,271,087	P13T	unknown	Het
Sec14l3	A	G	11: 4,075,209	D273G	possibly damaging	Het
Slco2a1	T	A	9: 103,050,166	I86N	probably damaging	Het
Smg1	A	T	7: 118,213,012	S19T	probably benign	Het
Stk32a	T	C	18: 43,305,017	S194P	probably benign	Het
Syna	G	A	5: 134,559,570	S175L	possibly damaging	Het
Taf4	G	A	2: 179,932,029	T682M	probably damaging	Het
Tmem151b	T	C	17: 45,547,119	Y67C	probably damaging	Het
Tshz1	C	T	18: 84,015,467	R272Q	probably damaging	Het
Tti1	A	G	2: 158,008,195	S375P	probably damaging	Het
Vcan	T	C	13: 89,725,517	K73E	probably damaging	Het
Vmn1r202	C	T	13: 22,501,750	V166I	probably benign	Het
Vmn2r10	A	G	5: 109,006,420	V6A	probably benign	Het
Zfhx4	A	G	3: 5,242,047	D111G	probably damaging	Het
Zhx1	C	G	15: 58,054,074	G259R	probably damaging	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
R8732:Eml5	UTSW	12	98815959	missense	probably damaging	0.99
R8956:Eml5	UTSW	12	98852693	missense	possibly damaging	0.69
R8975:Eml5	UTSW	12	98810570	missense	probably damaging	0.99
R9131:Eml5	UTSW	12	98858840	missense	probably damaging	1.00
R9258:Eml5	UTSW	12	98844117	missense	possibly damaging	0.77
R9261:Eml5	UTSW	12	98856028	missense	probably damaging	0.99
R9276:Eml5	UTSW	12	98798801	missense	probably damaging	0.99
R9301:Eml5	UTSW	12	98882033	nonsense	probably null
R9368:Eml5	UTSW	12	98796578	missense	probably benign	0.31
R9392:Eml5	UTSW	12	98900940	missense	probably damaging	1.00
R9393:Eml5	UTSW	12	98876174	missense	probably benign	0.35
R9449:Eml5	UTSW	12	98861295	missense	probably damaging	1.00
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGAATCAGCATGCCATTAAG -3'
(R):5'- TCCTCATGATGACACATACAGC -3'

Sequencing Primer
(F):5'- TGGGTAGCCTCAATTTCACTATG -3'
(R):5'- CTGTGTCTGCTGATAATTGATTTGCC -3'

Posted On

2016-06-15