Incidental Mutation 'R5124:Fam186a'
ID393469
Institutional Source Beutler Lab
Gene Symbol Fam186a
Ensembl Gene ENSMUSG00000045350
Gene Namefamily with sequence similarity 186, member A
SynonymsLOC380973, 1700030F18Rik
MMRRC Submission 042712-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5124 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99918348-99967061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99943096 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1756 (S1756P)
Ref Sequence ENSEMBL: ENSMUSP00000097783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100209]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100209
AA Change: S1756P

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097783
Gene: ENSMUSG00000045350
AA Change: S1756P

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:FBG 44 222 4e-48 BLAST
coiled coil region 292 340 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
internal_repeat_2 743 1156 1.05e-58 PROSPERO
internal_repeat_1 833 1270 7.71e-59 PROSPERO
low complexity region 1271 1285 N/A INTRINSIC
low complexity region 1289 1300 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1327 1338 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1365 1376 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1498 1509 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1547 N/A INTRINSIC
low complexity region 1555 1566 N/A INTRINSIC
low complexity region 1574 1585 N/A INTRINSIC
internal_repeat_1 1586 1981 7.71e-59 PROSPERO
internal_repeat_2 1737 2197 1.05e-58 PROSPERO
low complexity region 2367 2378 N/A INTRINSIC
low complexity region 2549 2564 N/A INTRINSIC
low complexity region 2644 2655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180309
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adpgk A G 9: 59,315,278 D496G possibly damaging Het
Agbl4 A G 4: 111,656,328 M424V probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Bpifa3 C T 2: 154,138,137 Q230* probably null Het
Cog4 G T 8: 110,847,193 R48L probably damaging Het
Cop1 A G 1: 159,278,112 Y33C probably damaging Het
Cyp26a1 A T 19: 37,701,217 I454L probably benign Het
Ddr1 T C 17: 35,683,597 H762R probably damaging Het
Dnajc2 A T 5: 21,763,484 S328T probably benign Het
Dppa2 G T 16: 48,311,623 V28F probably damaging Het
Dusp15 T A 2: 152,951,355 M1L possibly damaging Het
Eml5 G A 12: 98,792,042 T1875M probably damaging Het
Gm436 A T 4: 144,674,719 I65N probably damaging Het
Gm5431 T A 11: 48,889,039 Q630L probably benign Het
Gm9733 T A 3: 15,320,579 R88* probably null Het
H6pd A G 4: 149,982,055 S625P possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnj6 G T 16: 94,832,659 P180T probably damaging Het
Lpin3 T A 2: 160,897,061 M263K probably benign Het
Lrp2 A T 2: 69,501,490 D1640E probably damaging Het
Lypd2 C T 15: 74,732,498 A74T probably benign Het
Map4k1 T C 7: 28,988,832 L223P probably damaging Het
Myh7 A T 14: 54,985,742 Y715* probably null Het
Myo9b T C 8: 71,355,839 S1697P probably damaging Het
Neb T C 2: 52,281,498 E1661G probably damaging Het
Nek8 A T 11: 78,172,939 M80K probably damaging Het
Nup188 T A 2: 30,330,935 L979Q probably damaging Het
Olfr1218 A T 2: 89,055,087 V113D probably damaging Het
P4htm T A 9: 108,581,942 S264C possibly damaging Het
Pcdha8 A G 18: 36,993,715 T417A probably benign Het
Pclo T C 5: 14,677,392 probably benign Het
Prox1 T A 1: 190,161,279 N323I possibly damaging Het
Prune2 A T 19: 17,199,910 R222S probably damaging Het
Psmd2 C A 16: 20,652,698 R100S possibly damaging Het
Qrich2 A T 11: 116,446,773 M1963K probably damaging Het
Rbm39 C T 2: 156,159,162 G324D probably damaging Het
Rhobtb1 A T 10: 69,269,901 probably null Het
Rhov G T 2: 119,271,087 P13T unknown Het
Sec14l3 A G 11: 4,075,209 D273G possibly damaging Het
Slco2a1 T A 9: 103,050,166 I86N probably damaging Het
Smg1 A T 7: 118,213,012 S19T probably benign Het
Stk32a T C 18: 43,305,017 S194P probably benign Het
Syna G A 5: 134,559,570 S175L possibly damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmem151b T C 17: 45,547,119 Y67C probably damaging Het
Tshz1 C T 18: 84,015,467 R272Q probably damaging Het
Tti1 A G 2: 158,008,195 S375P probably damaging Het
Vcan T C 13: 89,725,517 K73E probably damaging Het
Vmn1r202 C T 13: 22,501,750 V166I probably benign Het
Vmn2r10 A G 5: 109,006,420 V6A probably benign Het
Zfhx4 A G 3: 5,242,047 D111G probably damaging Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Other mutations in Fam186a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam186a APN 15 99927691 splice site probably benign
IGL03047:Fam186a UTSW 15 99945708 missense unknown
R0172:Fam186a UTSW 15 99954887 missense unknown
R0194:Fam186a UTSW 15 99941763 missense possibly damaging 0.92
R0381:Fam186a UTSW 15 99942174 missense probably damaging 0.97
R0799:Fam186a UTSW 15 99942012 missense probably damaging 1.00
R1295:Fam186a UTSW 15 99939789 splice site probably benign
R1366:Fam186a UTSW 15 99943389 missense possibly damaging 0.89
R1519:Fam186a UTSW 15 99947655 missense unknown
R1592:Fam186a UTSW 15 99940318 missense probably benign 0.01
R1636:Fam186a UTSW 15 99941658 missense unknown
R1719:Fam186a UTSW 15 99942346 missense possibly damaging 0.54
R1759:Fam186a UTSW 15 99966881 nonsense probably null
R1856:Fam186a UTSW 15 99940302 missense possibly damaging 0.82
R2131:Fam186a UTSW 15 99933676 unclassified probably benign
R2192:Fam186a UTSW 15 99940311 missense possibly damaging 0.90
R2239:Fam186a UTSW 15 99954864 missense unknown
R2251:Fam186a UTSW 15 99945097 missense probably benign 0.02
R2902:Fam186a UTSW 15 99945168 missense possibly damaging 0.73
R3037:Fam186a UTSW 15 99943794 missense probably damaging 0.99
R3744:Fam186a UTSW 15 99947535 missense unknown
R4021:Fam186a UTSW 15 99941799 missense possibly damaging 0.66
R4183:Fam186a UTSW 15 99933685 unclassified probably benign
R4238:Fam186a UTSW 15 99943642 missense probably benign 0.05
R4667:Fam186a UTSW 15 99944532 missense possibly damaging 0.92
R4817:Fam186a UTSW 15 99933538 unclassified probably benign
R4835:Fam186a UTSW 15 99945808 missense unknown
R4837:Fam186a UTSW 15 99940797 missense unknown
R4897:Fam186a UTSW 15 99945277 missense possibly damaging 0.66
R4902:Fam186a UTSW 15 99946842 missense unknown
R4950:Fam186a UTSW 15 99941653 missense unknown
R4995:Fam186a UTSW 15 99945099 missense probably benign 0.27
R5062:Fam186a UTSW 15 99944646 missense possibly damaging 0.66
R5133:Fam186a UTSW 15 99955493 missense unknown
R5424:Fam186a UTSW 15 99945763 missense unknown
R5624:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5628:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5637:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5639:Fam186a UTSW 15 99947050 missense unknown
R5652:Fam186a UTSW 15 99945372 missense possibly damaging 0.79
R5673:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5799:Fam186a UTSW 15 99966824 nonsense probably null
R5965:Fam186a UTSW 15 99945097 missense probably benign 0.37
R6044:Fam186a UTSW 15 99941997 missense probably damaging 0.97
R6077:Fam186a UTSW 15 99942703 missense possibly damaging 0.46
R6120:Fam186a UTSW 15 99940363 missense probably benign 0.00
R6185:Fam186a UTSW 15 99947649 missense unknown
R6186:Fam186a UTSW 15 99947325 missense unknown
R6242:Fam186a UTSW 15 99939907 missense unknown
R6351:Fam186a UTSW 15 99941742 missense probably damaging 0.97
R6368:Fam186a UTSW 15 99943317 missense possibly damaging 0.66
R6369:Fam186a UTSW 15 99947331 missense unknown
R6559:Fam186a UTSW 15 99944475 missense possibly damaging 0.46
R6855:Fam186a UTSW 15 99954875 missense unknown
R6867:Fam186a UTSW 15 99945850 missense unknown
R6957:Fam186a UTSW 15 99946476 missense unknown
R6961:Fam186a UTSW 15 99940201 missense probably benign 0.16
R6994:Fam186a UTSW 15 99942466 missense probably benign 0.35
R6996:Fam186a UTSW 15 99955493 missense unknown
R7062:Fam186a UTSW 15 99933640 unclassified probably benign
R7064:Fam186a UTSW 15 99941676 missense unknown
R7173:Fam186a UTSW 15 99945650 missense unknown
R7244:Fam186a UTSW 15 99946392 missense unknown
R7270:Fam186a UTSW 15 99944152 missense possibly damaging 0.66
R7410:Fam186a UTSW 15 99946945 nonsense probably null
R7437:Fam186a UTSW 15 99942894 missense probably damaging 1.00
R7475:Fam186a UTSW 15 99947514 missense unknown
R7487:Fam186a UTSW 15 99942136 missense possibly damaging 0.66
R7526:Fam186a UTSW 15 99941915 missense possibly damaging 0.83
R7650:Fam186a UTSW 15 99939907 missense unknown
R7658:Fam186a UTSW 15 99939844 missense unknown
R7663:Fam186a UTSW 15 99945069 missense probably benign 0.00
R7703:Fam186a UTSW 15 99954797 missense unknown
R7814:Fam186a UTSW 15 99944664 missense possibly damaging 0.92
X0021:Fam186a UTSW 15 99945435 missense probably benign 0.00
Z1088:Fam186a UTSW 15 99945994 missense unknown
Predicted Primers PCR Primer
(F):5'- AACTGTGAGAATTATCCCTAGGG -3'
(R):5'- TCTGGGAATCACTGTCAGCC -3'

Sequencing Primer
(F):5'- GCCTCCTCAGGGGTCAGAC -3'
(R):5'- GAATCACTGTCAGCCCTGAG -3'
Posted On2016-06-15