Incidental Mutation 'R5124:Cyp26a1'
ID393479
Institutional Source Beutler Lab
Gene Symbol Cyp26a1
Ensembl Gene ENSMUSG00000024987
Gene Namecytochrome P450, family 26, subfamily a, polypeptide 1
SynonymsCyp26, P450RA, P450RAI, retinoic acid hydrolase, RAH
MMRRC Submission 042712-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5124 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location37697808-37701528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37701217 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 454 (I454L)
Ref Sequence ENSEMBL: ENSMUSP00000025946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025946]
Predicted Effect probably benign
Transcript: ENSMUST00000025946
AA Change: I454L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000025946
Gene: ENSMUSG00000024987
AA Change: I454L

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:p450 45 487 2.4e-68 PFAM
Meta Mutation Damage Score 0.1391 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein acts on retinoids, including all-trans-retinoic acid (RA), with both 4-hydroxylation and 18-hydroxylation activities. This enzyme regulates the cellular level of retinoic acid which is involved in regulation of gene expression in both embryonic and adult tissues. Two alternatively spliced transcript variants of this gene, which encode the distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die during mid-late gestation and exhibit spina bifida, caudal agenesis, and abnormalities of the kidneys, urogenital tract, hindgut, cervical vertebrae, and rostral hindbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adpgk A G 9: 59,315,278 D496G possibly damaging Het
Agbl4 A G 4: 111,656,328 M424V probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Bpifa3 C T 2: 154,138,137 Q230* probably null Het
Cog4 G T 8: 110,847,193 R48L probably damaging Het
Cop1 A G 1: 159,278,112 Y33C probably damaging Het
Ddr1 T C 17: 35,683,597 H762R probably damaging Het
Dnajc2 A T 5: 21,763,484 S328T probably benign Het
Dppa2 G T 16: 48,311,623 V28F probably damaging Het
Dusp15 T A 2: 152,951,355 M1L possibly damaging Het
Eml5 G A 12: 98,792,042 T1875M probably damaging Het
Fam186a A G 15: 99,943,096 S1756P possibly damaging Het
Gm436 A T 4: 144,674,719 I65N probably damaging Het
Gm5431 T A 11: 48,889,039 Q630L probably benign Het
Gm9733 T A 3: 15,320,579 R88* probably null Het
H6pd A G 4: 149,982,055 S625P possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnj6 G T 16: 94,832,659 P180T probably damaging Het
Lpin3 T A 2: 160,897,061 M263K probably benign Het
Lrp2 A T 2: 69,501,490 D1640E probably damaging Het
Lypd2 C T 15: 74,732,498 A74T probably benign Het
Map4k1 T C 7: 28,988,832 L223P probably damaging Het
Myh7 A T 14: 54,985,742 Y715* probably null Het
Myo9b T C 8: 71,355,839 S1697P probably damaging Het
Neb T C 2: 52,281,498 E1661G probably damaging Het
Nek8 A T 11: 78,172,939 M80K probably damaging Het
Nup188 T A 2: 30,330,935 L979Q probably damaging Het
Olfr1218 A T 2: 89,055,087 V113D probably damaging Het
P4htm T A 9: 108,581,942 S264C possibly damaging Het
Pcdha8 A G 18: 36,993,715 T417A probably benign Het
Pclo T C 5: 14,677,392 probably benign Het
Prox1 T A 1: 190,161,279 N323I possibly damaging Het
Prune2 A T 19: 17,199,910 R222S probably damaging Het
Psmd2 C A 16: 20,652,698 R100S possibly damaging Het
Qrich2 A T 11: 116,446,773 M1963K probably damaging Het
Rbm39 C T 2: 156,159,162 G324D probably damaging Het
Rhobtb1 A T 10: 69,269,901 probably null Het
Rhov G T 2: 119,271,087 P13T unknown Het
Sec14l3 A G 11: 4,075,209 D273G possibly damaging Het
Slco2a1 T A 9: 103,050,166 I86N probably damaging Het
Smg1 A T 7: 118,213,012 S19T probably benign Het
Stk32a T C 18: 43,305,017 S194P probably benign Het
Syna G A 5: 134,559,570 S175L possibly damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmem151b T C 17: 45,547,119 Y67C probably damaging Het
Tshz1 C T 18: 84,015,467 R272Q probably damaging Het
Tti1 A G 2: 158,008,195 S375P probably damaging Het
Vcan T C 13: 89,725,517 K73E probably damaging Het
Vmn1r202 C T 13: 22,501,750 V166I probably benign Het
Vmn2r10 A G 5: 109,006,420 V6A probably benign Het
Zfhx4 A G 3: 5,242,047 D111G probably damaging Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Other mutations in Cyp26a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Cyp26a1 APN 19 37700002 missense probably benign 0.00
IGL01398:Cyp26a1 APN 19 37697947 missense probably damaging 1.00
IGL01624:Cyp26a1 APN 19 37698333 missense possibly damaging 0.94
IGL02398:Cyp26a1 APN 19 37700019 missense probably benign
IGL02437:Cyp26a1 APN 19 37698495 missense probably benign
IGL02709:Cyp26a1 APN 19 37699978 missense probably damaging 1.00
IGL02712:Cyp26a1 APN 19 37699978 missense probably damaging 1.00
R0834:Cyp26a1 UTSW 19 37699957 missense probably damaging 0.96
R1517:Cyp26a1 UTSW 19 37698860 missense probably benign
R1696:Cyp26a1 UTSW 19 37701178 missense probably benign 0.02
R1831:Cyp26a1 UTSW 19 37700623 missense probably damaging 0.98
R2040:Cyp26a1 UTSW 19 37698051 missense possibly damaging 0.46
R2504:Cyp26a1 UTSW 19 37698342 missense probably damaging 1.00
R4693:Cyp26a1 UTSW 19 37698477 missense probably benign 0.11
R4808:Cyp26a1 UTSW 19 37701125 missense probably benign
R5412:Cyp26a1 UTSW 19 37701182 missense probably damaging 1.00
R5964:Cyp26a1 UTSW 19 37699962 missense probably damaging 1.00
R6355:Cyp26a1 UTSW 19 37698929 missense possibly damaging 0.46
R6426:Cyp26a1 UTSW 19 37699305 missense probably benign 0.14
R6501:Cyp26a1 UTSW 19 37699070 missense possibly damaging 0.80
R6734:Cyp26a1 UTSW 19 37701212 missense probably damaging 1.00
R7019:Cyp26a1 UTSW 19 37698812 missense probably damaging 1.00
R7188:Cyp26a1 UTSW 19 37699305 missense possibly damaging 0.64
R7667:Cyp26a1 UTSW 19 37700624 missense possibly damaging 0.83
R7694:Cyp26a1 UTSW 19 37701064 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TTACAGTATCTGTGACACCCAC -3'
(R):5'- CACGGGACTGTAGTAGAGACAC -3'

Sequencing Primer
(F):5'- CACGATGTGGCAGATATCTTCAC -3'
(R):5'- GGGTAAATCTTGCAGGGA -3'
Posted On2016-06-15