Mutagenetix > Incidental Mutations

Incidental Mutation 'R5125:Zc3h6'

393482

Institutional Source

Beutler Lab

Gene Symbol

Zc3h6

Ensembl Gene

ENSMUSG00000042851

Gene Name

zinc finger CCCH type containing 6

Synonyms

MMRRC Submission

042713-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.288) question?

Stock #

R5125 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128967402-129018563 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 129014479 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 493 (H493R)

Ref Sequence

ENSEMBL: ENSMUSP00000105949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110320]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110320
AA Change: H493R

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: H493R

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
coiled coil region	30	71	N/A	INTRINSIC
low complexity region	74	88	N/A	INTRINSIC
low complexity region	177	192	N/A	INTRINSIC
ZnF_C3H1	271	296	1.72e-4	SMART
ZnF_C3H1	300	325	2.51e-6	SMART
ZnF_C3H1	326	349	5.24e0	SMART
coiled coil region	351	383	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	493	509	N/A	INTRINSIC
low complexity region	698	707	N/A	INTRINSIC
low complexity region	784	798	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
low complexity region	876	890	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135186

Meta Mutation Damage Score

0.0665

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

96% (49/51)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abt1	G	T	13: 23,422,649	A94E	possibly damaging	Het
Carmil2	G	T	8: 105,696,889	G1207V	probably damaging	Het
Cyp2c66	A	G	19: 39,171,029	Y308C	probably damaging	Het
Dcc	A	G	18: 71,456,877	F683L	probably benign	Het
Denr	A	T	5: 123,927,081	I166F	probably damaging	Het
Dhx29	T	G	13: 112,932,600	S155A	possibly damaging	Het
Dsg1b	G	A	18: 20,397,503	G405E	probably damaging	Het
Ei24	T	A	9: 36,782,446		probably benign	Het
Exo5	A	T	4: 120,921,537		probably null	Het
Gm15922	T	A	7: 3,739,397	K44*	probably null	Het
Gm7356	T	C	17: 14,001,314	D151G	probably damaging	Het
Grin1	T	C	2: 25,296,827		probably benign	Het
Grin2b	C	T	6: 135,923,299	V195M	possibly damaging	Het
Hephl1	T	A	9: 15,086,172	K399N	probably damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kmt2c	A	G	5: 25,284,381	V4520A	probably damaging	Het
Lair1	G	A	7: 4,010,489	T82I	possibly damaging	Het
Lmx1a	C	T	1: 167,830,687	S213L	possibly damaging	Het
Ly6g6d	A	G	17: 35,074,442	I8T	possibly damaging	Het
Mcm4	T	A	16: 15,635,303	D174V	probably benign	Het
Mcph1	T	A	8: 18,607,326	D60E	probably damaging	Het
Med12l	G	A	3: 59,267,214	G1851D	possibly damaging	Het
Olfr156	T	A	4: 43,820,480	I294F	probably benign	Het
Olfr868	T	A	9: 20,101,192	C144*	probably null	Het
P2rx2	G	A	5: 110,342,651	T66I	possibly damaging	Het
Pcdh15	A	G	10: 74,584,080	E1197G	probably damaging	Het
Ppwd1	A	T	13: 104,220,435	S191T	probably benign	Het
Rbm39	A	T	2: 156,162,865	M184K	probably damaging	Het
Reln	A	G	5: 21,913,241	V2935A	possibly damaging	Het
Robo4	T	C	9: 37,407,960	W535R	probably damaging	Het
Rsf1	A	G	7: 97,661,872	D603G	possibly damaging	Het
Sh3rf3	C	G	10: 59,131,190	P785A	probably benign	Het
Slc22a26	T	C	19: 7,790,175	T289A	possibly damaging	Het
Slc24a3	T	C	2: 145,518,847	V120A	possibly damaging	Het
Sost	C	T	11: 101,963,941	G181R	probably damaging	Het
Sp2	A	G	11: 96,955,838	F554L	probably benign	Het
Stim2	T	C	5: 54,110,597	S87P	probably damaging	Het
Tcrg-C4	A	G	13: 19,344,762		probably benign	Het
Tecta	T	C	9: 42,375,185	D725G	probably damaging	Het
Ube4b	T	C	4: 149,342,992	M900V	probably damaging	Het
Ugt2b38	A	G	5: 87,411,812	M407T	probably damaging	Het
Vmn1r87	G	T	7: 13,131,865	A165E	possibly damaging	Het
Zfhx2	A	T	14: 55,074,775	F154Y	probably benign	Het
Zfp729a	A	G	13: 67,637,645		probably null	Het
Zfp976	A	G	7: 42,612,501		probably null	Het
Zhx1	C	G	15: 58,054,074	G259R	probably damaging	Het
Znfx1	A	T	2: 167,046,939	V783E	possibly damaging	Het

Other mutations in Zc3h6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01732:Zc3h6	APN	2	129011875	missense	probably damaging	1.00
IGL01880:Zc3h6	APN	2	129017378	missense	probably damaging	0.99
IGL02160:Zc3h6	APN	2	128997685	missense	probably benign	0.02
IGL02161:Zc3h6	APN	2	128993226	missense	possibly damaging	0.90
IGL02202:Zc3h6	APN	2	129016581	missense	probably damaging	1.00
IGL02547:Zc3h6	APN	2	129015611	missense	probably benign	0.00
IGL02973:Zc3h6	APN	2	128997795	missense	probably damaging	0.98
BB001:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
BB011:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R0336:Zc3h6	UTSW	2	129015412	missense	possibly damaging	0.81
R0420:Zc3h6	UTSW	2	129014827	missense	probably benign	0.00
R0538:Zc3h6	UTSW	2	129017223	missense	possibly damaging	0.75
R0944:Zc3h6	UTSW	2	129006816	missense	probably damaging	1.00
R1151:Zc3h6	UTSW	2	129017136	missense	probably benign	0.00
R1528:Zc3h6	UTSW	2	129017069	missense	probably benign	0.01
R1698:Zc3h6	UTSW	2	129017358	missense	probably benign
R1712:Zc3h6	UTSW	2	129016734	missense	probably damaging	1.00
R1913:Zc3h6	UTSW	2	129016620	missense	probably damaging	1.00
R1926:Zc3h6	UTSW	2	128997795	missense	probably damaging	0.98
R2030:Zc3h6	UTSW	2	129006086	missense	probably damaging	1.00
R2051:Zc3h6	UTSW	2	129015618	missense	possibly damaging	0.55
R2133:Zc3h6	UTSW	2	128967830	missense	possibly damaging	0.53
R2273:Zc3h6	UTSW	2	129014709	missense	probably benign	0.01
R2328:Zc3h6	UTSW	2	128993202	missense	possibly damaging	0.85
R2862:Zc3h6	UTSW	2	129015460	missense	probably benign	0.43
R2899:Zc3h6	UTSW	2	129002232	missense	probably benign	0.00
R3711:Zc3h6	UTSW	2	129017331	missense	probably benign	0.00
R3743:Zc3h6	UTSW	2	128997792	missense	probably damaging	1.00
R3893:Zc3h6	UTSW	2	129016140	missense	probably damaging	1.00
R4748:Zc3h6	UTSW	2	129002240	missense	probably damaging	1.00
R5025:Zc3h6	UTSW	2	129010433	missense	possibly damaging	0.87
R5026:Zc3h6	UTSW	2	129017309	missense	probably benign	0.00
R5373:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5374:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5703:Zc3h6	UTSW	2	128993452	intron	probably benign
R5802:Zc3h6	UTSW	2	129015559	missense	possibly damaging	0.56
R5876:Zc3h6	UTSW	2	128993277	missense	probably benign	0.29
R5879:Zc3h6	UTSW	2	128997776	splice site	probably null
R5950:Zc3h6	UTSW	2	128997790	nonsense	probably null
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6781:Zc3h6	UTSW	2	129015421	missense	probably damaging	0.99
R7323:Zc3h6	UTSW	2	128993411	missense	unknown
R7340:Zc3h6	UTSW	2	128993190	missense	possibly damaging	0.90
R7572:Zc3h6	UTSW	2	129017252	missense	probably benign	0.02
R7576:Zc3h6	UTSW	2	129014553	missense	probably damaging	1.00
R7797:Zc3h6	UTSW	2	129015635	critical splice donor site	probably null
R7924:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R8048:Zc3h6	UTSW	2	129017014	missense	probably benign	0.30
Z1176:Zc3h6	UTSW	2	129016221	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CATTTTGAACTGAAAATTGCTGGG -3'
(R):5'- TTTCACCGAGTGTCCTGGAAAG -3'

Sequencing Primer
(F):5'- AACTGAAAATTGCTGGGTTTTGTTC -3'
(R):5'- AGTGTCCTGGAAAGCCCGG -3'

Posted On

2016-06-15