Incidental Mutation 'R5125:Slc24a3'
ID393483
Institutional Source Beutler Lab
Gene Symbol Slc24a3
Ensembl Gene ENSMUSG00000063873
Gene Namesolute carrier family 24 (sodium/potassium/calcium exchanger), member 3
SynonymsNCKX3
MMRRC Submission 042713-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R5125 (G1)
Quality Score208
Status Validated
Chromosome2
Chromosomal Location145167754-145642166 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145518847 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 120 (V120A)
Ref Sequence ENSEMBL: ENSMUSP00000079897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081121] [ENSMUST00000110007]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081121
AA Change: V120A

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079897
Gene: ENSMUSG00000063873
AA Change: V120A

DomainStartEndE-ValueType
Pfam:Na_Ca_ex 72 204 8.6e-33 PFAM
coiled coil region 353 382 N/A INTRINSIC
Pfam:Na_Ca_ex 437 577 2.1e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110007
AA Change: V170A

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105634
Gene: ENSMUSG00000063873
AA Change: V170A

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Na_Ca_ex 112 255 2.6e-32 PFAM
coiled coil region 403 432 N/A INTRINSIC
Pfam:Na_Ca_ex 477 629 6.1e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153249
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plasma membrane sodium/calcium exchangers are an important component of intracellular calcium homeostasis and electrical conduction. Potassium-dependent sodium/calcium exchangers such as SLC24A3 are believed to transport 1 intracellular calcium and 1 potassium ion in exchange for 4 extracellular sodium ions (Kraev et al., 2001 [PubMed 11294880]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dcc A G 18: 71,456,877 F683L probably benign Het
Denr A T 5: 123,927,081 I166F probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Ei24 T A 9: 36,782,446 probably benign Het
Exo5 A T 4: 120,921,537 probably null Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gm7356 T C 17: 14,001,314 D151G probably damaging Het
Grin1 T C 2: 25,296,827 probably benign Het
Grin2b C T 6: 135,923,299 V195M possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kmt2c A G 5: 25,284,381 V4520A probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lmx1a C T 1: 167,830,687 S213L possibly damaging Het
Ly6g6d A G 17: 35,074,442 I8T possibly damaging Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Med12l G A 3: 59,267,214 G1851D possibly damaging Het
Olfr156 T A 4: 43,820,480 I294F probably benign Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
P2rx2 G A 5: 110,342,651 T66I possibly damaging Het
Pcdh15 A G 10: 74,584,080 E1197G probably damaging Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Rbm39 A T 2: 156,162,865 M184K probably damaging Het
Reln A G 5: 21,913,241 V2935A possibly damaging Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Sh3rf3 C G 10: 59,131,190 P785A probably benign Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Sost C T 11: 101,963,941 G181R probably damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Stim2 T C 5: 54,110,597 S87P probably damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Ugt2b38 A G 5: 87,411,812 M407T probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Zc3h6 A G 2: 129,014,479 H493R possibly damaging Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Znfx1 A T 2: 167,046,939 V783E possibly damaging Het
Other mutations in Slc24a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Slc24a3 APN 2 145616714 critical splice donor site probably null
IGL01327:Slc24a3 APN 2 145602558 missense probably benign
IGL01413:Slc24a3 APN 2 145640249 missense probably damaging 1.00
IGL01418:Slc24a3 APN 2 145640249 missense probably damaging 1.00
IGL01468:Slc24a3 APN 2 145613580 missense probably benign 0.16
IGL01629:Slc24a3 APN 2 145640210 splice site probably benign
IGL01973:Slc24a3 APN 2 145245027 missense probably benign 0.01
IGL02021:Slc24a3 APN 2 145518916 missense probably damaging 1.00
IGL02378:Slc24a3 APN 2 145518402 missense possibly damaging 0.78
R0242:Slc24a3 UTSW 2 145606664 missense probably benign 0.02
R0242:Slc24a3 UTSW 2 145606664 missense probably benign 0.02
R0685:Slc24a3 UTSW 2 145606795 missense probably benign 0.00
R0827:Slc24a3 UTSW 2 145518492 splice site probably benign
R1669:Slc24a3 UTSW 2 145613592 missense probably damaging 1.00
R2698:Slc24a3 UTSW 2 145613567 missense probably benign 0.01
R3796:Slc24a3 UTSW 2 145616681 missense probably damaging 1.00
R4073:Slc24a3 UTSW 2 145613716 intron probably benign
R4386:Slc24a3 UTSW 2 145606826 missense probably benign 0.00
R5169:Slc24a3 UTSW 2 145640264 missense probably benign 0.18
R5248:Slc24a3 UTSW 2 145604517 missense probably benign 0.40
R5394:Slc24a3 UTSW 2 145613574 missense probably benign 0.42
R5549:Slc24a3 UTSW 2 145606864 missense probably damaging 1.00
R6476:Slc24a3 UTSW 2 145606830 missense probably benign
R6777:Slc24a3 UTSW 2 145640282 missense probably damaging 1.00
R6814:Slc24a3 UTSW 2 145616710 nonsense probably null
R7163:Slc24a3 UTSW 2 145244991 missense probably benign
R7446:Slc24a3 UTSW 2 145580982 missense probably damaging 1.00
R7525:Slc24a3 UTSW 2 145613530 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATTCACTGGTTTAACTGTGTGC -3'
(R):5'- TCCAACATGATGGTCCCTGC -3'

Sequencing Primer
(F):5'- GAACTTTTCCTAGACCCAGGG -3'
(R):5'- ATGATGGTCCCTGCCTCGG -3'
Posted On2016-06-15