Mutagenetix > Incidental Mutation

Incidental Mutation 'R5125:Reln'

393490

Institutional Source

Beutler Lab

Gene Symbol

Reln

Ensembl Gene

ENSMUSG00000042453

Gene Name

reelin

Synonyms

MMRRC Submission

042713-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R5125 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21884454-22344702 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21913241 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 2935 (V2935A)

Ref Sequence

ENSEMBL: ENSMUSP00000124052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062372
AA Change: V2935A

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: V2935A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	40	172	6.1e-24	PFAM
internal_repeat_3	195	360	5.04e-6	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3450	3457	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000084713

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159768

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161356
AA Change: V2935A

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: V2935A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	54	171	2.9e-10	PFAM
internal_repeat_3	195	360	5.06e-6	PROSPERO
internal_repeat_2	207	413	3.41e-11	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
internal_repeat_2	1452	1660	3.41e-11	PROSPERO
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3452	3459	N/A	INTRINSIC

Meta Mutation Damage Score

0.0638

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

96% (49/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abt1	G	T	13: 23,422,649 (GRCm38)	A94E	possibly damaging	Het
Carmil2	G	T	8: 105,696,889 (GRCm38)	G1207V	probably damaging	Het
Cyp2c66	A	G	19: 39,171,029 (GRCm38)	Y308C	probably damaging	Het
Dcc	A	G	18: 71,456,877 (GRCm38)	F683L	probably benign	Het
Denr	A	T	5: 123,927,081 (GRCm38)	I166F	probably damaging	Het
Dhx29	T	G	13: 112,932,600 (GRCm38)	S155A	possibly damaging	Het
Dsg1b	G	A	18: 20,397,503 (GRCm38)	G405E	probably damaging	Het
Ei24	T	A	9: 36,782,446 (GRCm38)		probably benign	Het
Exo5	A	T	4: 120,921,537 (GRCm38)		probably null	Het
Gm15922	T	A	7: 3,739,397 (GRCm38)	K44*	probably null	Het
Gm7356	T	C	17: 14,001,314 (GRCm38)	D151G	probably damaging	Het
Grin1	T	C	2: 25,296,827 (GRCm38)		probably benign	Het
Grin2b	C	T	6: 135,923,299 (GRCm38)	V195M	possibly damaging	Het
Hephl1	T	A	9: 15,086,172 (GRCm38)	K399N	probably damaging	Het
Itgb4	C	T	11: 115,984,157 (GRCm38)	R447W	probably benign	Het
Kmt2c	A	G	5: 25,284,381 (GRCm38)	V4520A	probably damaging	Het
Lair1	G	A	7: 4,010,489 (GRCm38)	T82I	possibly damaging	Het
Lmx1a	C	T	1: 167,830,687 (GRCm38)	S213L	possibly damaging	Het
Ly6g6d	A	G	17: 35,074,442 (GRCm38)	I8T	possibly damaging	Het
Mcm4	T	A	16: 15,635,303 (GRCm38)	D174V	probably benign	Het
Mcph1	T	A	8: 18,607,326 (GRCm38)	D60E	probably damaging	Het
Med12l	G	A	3: 59,267,214 (GRCm38)	G1851D	possibly damaging	Het
Olfr156	T	A	4: 43,820,480 (GRCm38)	I294F	probably benign	Het
Olfr868	T	A	9: 20,101,192 (GRCm38)	C144*	probably null	Het
P2rx2	G	A	5: 110,342,651 (GRCm38)	T66I	possibly damaging	Het
Pcdh15	A	G	10: 74,584,080 (GRCm38)	E1197G	probably damaging	Het
Ppwd1	A	T	13: 104,220,435 (GRCm38)	S191T	probably benign	Het
Rbm39	A	T	2: 156,162,865 (GRCm38)	M184K	probably damaging	Het
Robo4	T	C	9: 37,407,960 (GRCm38)	W535R	probably damaging	Het
Rsf1	A	G	7: 97,661,872 (GRCm38)	D603G	possibly damaging	Het
Sh3rf3	C	G	10: 59,131,190 (GRCm38)	P785A	probably benign	Het
Slc22a26	T	C	19: 7,790,175 (GRCm38)	T289A	possibly damaging	Het
Slc24a3	T	C	2: 145,518,847 (GRCm38)	V120A	possibly damaging	Het
Sost	C	T	11: 101,963,941 (GRCm38)	G181R	probably damaging	Het
Sp2	A	G	11: 96,955,838 (GRCm38)	F554L	probably benign	Het
Stim2	T	C	5: 54,110,597 (GRCm38)	S87P	probably damaging	Het
Tcrg-C4	A	G	13: 19,344,762 (GRCm38)		probably benign	Het
Tecta	T	C	9: 42,375,185 (GRCm38)	D725G	probably damaging	Het
Ube4b	T	C	4: 149,342,992 (GRCm38)	M900V	probably damaging	Het
Ugt2b38	A	G	5: 87,411,812 (GRCm38)	M407T	probably damaging	Het
Vmn1r87	G	T	7: 13,131,865 (GRCm38)	A165E	possibly damaging	Het
Zc3h6	A	G	2: 129,014,479 (GRCm38)	H493R	possibly damaging	Het
Zfhx2	A	T	14: 55,074,775 (GRCm38)	F154Y	probably benign	Het
Zfp729a	A	G	13: 67,637,645 (GRCm38)		probably null	Het
Zfp976	A	G	7: 42,612,501 (GRCm38)		probably null	Het
Zhx1	C	G	15: 58,054,074 (GRCm38)	G259R	probably damaging	Het
Znfx1	A	T	2: 167,046,939 (GRCm38)	V783E	possibly damaging	Het

Other mutations in Reln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL00091:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL00432:Reln	APN	5	22,010,127 (GRCm38)	missense	probably damaging	1.00
IGL00433:Reln	APN	5	22,045,009 (GRCm38)	missense	probably damaging	1.00
IGL00576:Reln	APN	5	22,154,950 (GRCm38)	missense	probably benign	0.01
IGL00755:Reln	APN	5	22,060,380 (GRCm38)	missense	probably damaging	0.98
IGL00777:Reln	APN	5	22,018,850 (GRCm38)	critical splice donor site	probably null
IGL00900:Reln	APN	5	21,980,117 (GRCm38)	missense	probably damaging	0.98
IGL01067:Reln	APN	5	21,979,666 (GRCm38)	missense	probably damaging	1.00
IGL01104:Reln	APN	5	21,986,967 (GRCm38)	missense	probably damaging	0.99
IGL01141:Reln	APN	5	21,969,033 (GRCm38)	missense	probably damaging	1.00
IGL01141:Reln	APN	5	21,919,069 (GRCm38)	missense	probably damaging	1.00
IGL01333:Reln	APN	5	22,171,251 (GRCm38)	missense	probably damaging	0.99
IGL01341:Reln	APN	5	21,969,079 (GRCm38)	missense	probably damaging	1.00
IGL01354:Reln	APN	5	21,919,175 (GRCm38)	nonsense	probably null
IGL01361:Reln	APN	5	21,919,021 (GRCm38)	missense	probably benign	0.06
IGL01446:Reln	APN	5	21,969,317 (GRCm38)	missense	probably damaging	0.99
IGL01448:Reln	APN	5	22,040,405 (GRCm38)	missense	probably benign	0.40
IGL01612:Reln	APN	5	21,896,930 (GRCm38)	missense	probably damaging	0.99
IGL01695:Reln	APN	5	21,920,438 (GRCm38)	missense	probably damaging	1.00
IGL01718:Reln	APN	5	21,947,514 (GRCm38)	missense	possibly damaging	0.60
IGL01749:Reln	APN	5	22,344,246 (GRCm38)	nonsense	probably null
IGL01875:Reln	APN	5	21,904,717 (GRCm38)	missense	probably benign
IGL02013:Reln	APN	5	21,950,879 (GRCm38)	missense	probably damaging	1.00
IGL02031:Reln	APN	5	21,979,016 (GRCm38)	missense	probably damaging	0.99
IGL02186:Reln	APN	5	21,909,958 (GRCm38)	missense	probably damaging	1.00
IGL02228:Reln	APN	5	21,904,731 (GRCm38)	missense	probably damaging	0.99
IGL02248:Reln	APN	5	21,910,992 (GRCm38)	missense	probably damaging	1.00
IGL02336:Reln	APN	5	21,929,134 (GRCm38)	missense	probably damaging	1.00
IGL02352:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL02359:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL02376:Reln	APN	5	22,080,791 (GRCm38)	nonsense	probably null
IGL02408:Reln	APN	5	21,901,619 (GRCm38)	missense	probably benign	0.44
IGL02415:Reln	APN	5	21,971,951 (GRCm38)	missense	possibly damaging	0.91
IGL02512:Reln	APN	5	22,040,427 (GRCm38)	missense	probably benign	0.00
IGL02540:Reln	APN	5	22,034,752 (GRCm38)	missense	probably damaging	0.96
IGL02624:Reln	APN	5	22,103,357 (GRCm38)	missense	probably benign	0.09
IGL02720:Reln	APN	5	21,997,941 (GRCm38)	missense	probably damaging	0.99
IGL02894:Reln	APN	5	21,885,548 (GRCm38)	missense	possibly damaging	0.72
IGL02999:Reln	APN	5	21,995,365 (GRCm38)	missense	probably damaging	1.00
IGL03125:Reln	APN	5	21,910,844 (GRCm38)	missense	probably damaging	1.00
IGL03298:Reln	APN	5	21,910,836 (GRCm38)	missense	probably damaging	0.99
Fishing	UTSW	5	21,896,841 (GRCm38)	missense	probably damaging	1.00
P0020:Reln	UTSW	5	22,106,060 (GRCm38)	missense	possibly damaging	0.91
PIT4151001:Reln	UTSW	5	22,286,896 (GRCm38)	missense	possibly damaging	0.71
R0018:Reln	UTSW	5	21,925,371 (GRCm38)	missense	probably benign	0.01
R0105:Reln	UTSW	5	22,048,815 (GRCm38)	missense	probably damaging	0.99
R0105:Reln	UTSW	5	22,048,815 (GRCm38)	missense	probably damaging	0.99
R0127:Reln	UTSW	5	22,004,136 (GRCm38)	missense	probably damaging	1.00
R0135:Reln	UTSW	5	22,128,649 (GRCm38)	missense	probably damaging	0.99
R0144:Reln	UTSW	5	21,948,449 (GRCm38)	missense	probably damaging	0.97
R0240:Reln	UTSW	5	22,106,045 (GRCm38)	missense	probably benign	0.36
R0240:Reln	UTSW	5	22,106,045 (GRCm38)	missense	probably benign	0.36
R0242:Reln	UTSW	5	21,942,597 (GRCm38)	critical splice donor site	probably null
R0242:Reln	UTSW	5	21,942,597 (GRCm38)	critical splice donor site	probably null
R0266:Reln	UTSW	5	21,988,776 (GRCm38)	missense	probably damaging	1.00
R0269:Reln	UTSW	5	21,920,537 (GRCm38)	missense	probably damaging	1.00
R0280:Reln	UTSW	5	22,227,513 (GRCm38)	splice site	probably benign
R0333:Reln	UTSW	5	21,929,242 (GRCm38)	missense	probably damaging	0.97
R0357:Reln	UTSW	5	21,950,822 (GRCm38)	missense	probably damaging	1.00
R0359:Reln	UTSW	5	22,048,800 (GRCm38)	missense	probably damaging	0.98
R0506:Reln	UTSW	5	21,920,496 (GRCm38)	missense	probably damaging	0.97
R0534:Reln	UTSW	5	21,947,408 (GRCm38)	missense	probably damaging	0.99
R0535:Reln	UTSW	5	22,051,276 (GRCm38)	splice site	probably benign
R0541:Reln	UTSW	5	21,980,109 (GRCm38)	missense	possibly damaging	0.88
R0615:Reln	UTSW	5	22,010,150 (GRCm38)	missense	probably benign	0.36
R0617:Reln	UTSW	5	21,920,537 (GRCm38)	missense	probably damaging	1.00
R0634:Reln	UTSW	5	22,018,869 (GRCm38)	missense	probably damaging	1.00
R0653:Reln	UTSW	5	21,913,230 (GRCm38)	missense	probably benign	0.44
R0704:Reln	UTSW	5	21,896,811 (GRCm38)	missense	probably damaging	0.99
R0706:Reln	UTSW	5	21,896,811 (GRCm38)	missense	probably damaging	0.99
R0959:Reln	UTSW	5	22,227,628 (GRCm38)	missense	probably damaging	0.96
R1066:Reln	UTSW	5	22,034,664 (GRCm38)	missense	probably damaging	1.00
R1110:Reln	UTSW	5	22,034,775 (GRCm38)	missense	probably benign
R1163:Reln	UTSW	5	21,899,029 (GRCm38)	missense	probably benign	0.03
R1222:Reln	UTSW	5	21,986,955 (GRCm38)	missense	probably null	0.97
R1226:Reln	UTSW	5	21,910,866 (GRCm38)	missense	probably damaging	1.00
R1440:Reln	UTSW	5	22,128,602 (GRCm38)	splice site	probably benign
R1532:Reln	UTSW	5	22,034,744 (GRCm38)	missense	probably damaging	0.99
R1552:Reln	UTSW	5	21,960,378 (GRCm38)	missense	probably benign	0.01
R1565:Reln	UTSW	5	21,925,213 (GRCm38)	missense	probably benign	0.05
R1618:Reln	UTSW	5	22,060,368 (GRCm38)	missense	probably benign	0.01
R1636:Reln	UTSW	5	21,998,683 (GRCm38)	missense	probably damaging	0.99
R1664:Reln	UTSW	5	21,929,086 (GRCm38)	missense	probably damaging	1.00
R1716:Reln	UTSW	5	21,955,095 (GRCm38)	missense	probably damaging	0.98
R1759:Reln	UTSW	5	22,010,289 (GRCm38)	missense	probably damaging	0.99
R1835:Reln	UTSW	5	21,979,002 (GRCm38)	missense	probably damaging	1.00
R1907:Reln	UTSW	5	22,044,962 (GRCm38)	critical splice donor site	probably null
R1991:Reln	UTSW	5	21,969,360 (GRCm38)	missense	possibly damaging	0.56
R2046:Reln	UTSW	5	21,942,627 (GRCm38)	missense	probably benign	0.01
R2072:Reln	UTSW	5	21,919,177 (GRCm38)	missense	probably damaging	1.00
R2103:Reln	UTSW	5	21,969,360 (GRCm38)	missense	possibly damaging	0.56
R2119:Reln	UTSW	5	22,019,000 (GRCm38)	missense	probably damaging	1.00
R2120:Reln	UTSW	5	21,969,085 (GRCm38)	missense	probably damaging	1.00
R2216:Reln	UTSW	5	22,048,005 (GRCm38)	missense	probably benign	0.30
R2219:Reln	UTSW	5	21,972,047 (GRCm38)	missense	possibly damaging	0.88
R2228:Reln	UTSW	5	21,987,078 (GRCm38)	missense	possibly damaging	0.69
R2306:Reln	UTSW	5	21,896,786 (GRCm38)	missense	probably damaging	1.00
R2316:Reln	UTSW	5	22,154,956 (GRCm38)	missense	probably benign	0.00
R2321:Reln	UTSW	5	21,915,020 (GRCm38)	missense	probably damaging	0.99
R2512:Reln	UTSW	5	21,979,690 (GRCm38)	missense	possibly damaging	0.89
R2519:Reln	UTSW	5	22,344,369 (GRCm38)	missense	unknown
R2870:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2870:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R3195:Reln	UTSW	5	22,040,420 (GRCm38)	missense	possibly damaging	0.72
R3545:Reln	UTSW	5	22,227,600 (GRCm38)	missense	possibly damaging	0.64
R3546:Reln	UTSW	5	22,227,600 (GRCm38)	missense	possibly damaging	0.64
R3547:Reln	UTSW	5	22,227,600 (GRCm38)	missense	possibly damaging	0.64
R3706:Reln	UTSW	5	21,995,589 (GRCm38)	splice site	probably benign
R3713:Reln	UTSW	5	21,904,734 (GRCm38)	missense	probably damaging	0.99
R3770:Reln	UTSW	5	21,948,566 (GRCm38)	missense	probably damaging	1.00
R3836:Reln	UTSW	5	21,911,014 (GRCm38)	missense	probably damaging	1.00
R3887:Reln	UTSW	5	21,910,849 (GRCm38)	missense	possibly damaging	0.92
R3972:Reln	UTSW	5	21,979,001 (GRCm38)	missense	probably damaging	0.99
R3975:Reln	UTSW	5	21,995,366 (GRCm38)	missense	possibly damaging	0.57
R4022:Reln	UTSW	5	22,227,630 (GRCm38)	missense	probably benign	0.45
R4044:Reln	UTSW	5	22,128,632 (GRCm38)	missense	possibly damaging	0.82
R4107:Reln	UTSW	5	22,034,584 (GRCm38)	missense	probably damaging	1.00
R4297:Reln	UTSW	5	21,920,487 (GRCm38)	missense	probably damaging	0.99
R4298:Reln	UTSW	5	21,920,487 (GRCm38)	missense	probably damaging	0.99
R4299:Reln	UTSW	5	21,920,487 (GRCm38)	missense	probably damaging	0.99
R4518:Reln	UTSW	5	21,901,743 (GRCm38)	missense	probably benign	0.44
R4615:Reln	UTSW	5	21,972,872 (GRCm38)	missense	possibly damaging	0.95
R4713:Reln	UTSW	5	22,152,463 (GRCm38)	missense	probably benign	0.17
R4720:Reln	UTSW	5	22,286,896 (GRCm38)	missense	possibly damaging	0.71
R4721:Reln	UTSW	5	21,919,222 (GRCm38)	missense	probably damaging	0.99
R4771:Reln	UTSW	5	22,049,700 (GRCm38)	missense	probably damaging	1.00
R4794:Reln	UTSW	5	22,344,185 (GRCm38)	missense	probably damaging	0.98
R4840:Reln	UTSW	5	22,018,846 (GRCm38)	splice site	probably null
R4860:Reln	UTSW	5	21,901,751 (GRCm38)	missense	probably benign	0.06
R4860:Reln	UTSW	5	21,901,751 (GRCm38)	missense	probably benign	0.06
R4896:Reln	UTSW	5	21,955,238 (GRCm38)	missense	probably damaging	1.00
R4908:Reln	UTSW	5	21,979,720 (GRCm38)	missense	probably benign	0.02
R4912:Reln	UTSW	5	21,925,193 (GRCm38)	missense	probably benign	0.29
R4922:Reln	UTSW	5	21,995,587 (GRCm38)	critical splice acceptor site	probably null
R4975:Reln	UTSW	5	21,960,426 (GRCm38)	missense	probably damaging	1.00
R4976:Reln	UTSW	5	21,971,870 (GRCm38)	missense	probably benign	0.05
R5020:Reln	UTSW	5	22,034,638 (GRCm38)	missense	probably damaging	1.00
R5037:Reln	UTSW	5	21,948,512 (GRCm38)	missense	probably damaging	1.00
R5082:Reln	UTSW	5	21,896,077 (GRCm38)	missense	probably benign	0.00
R5119:Reln	UTSW	5	21,971,870 (GRCm38)	missense	probably benign	0.05
R5137:Reln	UTSW	5	21,955,181 (GRCm38)	missense	probably damaging	1.00
R5152:Reln	UTSW	5	21,948,629 (GRCm38)	missense	probably damaging	1.00
R5154:Reln	UTSW	5	21,988,765 (GRCm38)	missense	probably damaging	0.99
R5259:Reln	UTSW	5	22,103,397 (GRCm38)	missense	possibly damaging	0.83
R5283:Reln	UTSW	5	22,011,163 (GRCm38)	missense	probably damaging	1.00
R5386:Reln	UTSW	5	22,039,529 (GRCm38)	missense	probably benign
R5400:Reln	UTSW	5	21,979,714 (GRCm38)	missense	probably damaging	1.00
R5478:Reln	UTSW	5	22,004,203 (GRCm38)	missense	probably benign	0.00
R5514:Reln	UTSW	5	21,971,885 (GRCm38)	missense	possibly damaging	0.93
R5529:Reln	UTSW	5	21,932,715 (GRCm38)	missense	possibly damaging	0.71
R5611:Reln	UTSW	5	22,039,665 (GRCm38)	nonsense	probably null
R5648:Reln	UTSW	5	21,998,572 (GRCm38)	missense	probably benign	0.04
R5649:Reln	UTSW	5	21,901,625 (GRCm38)	missense	probably benign	0.33
R5744:Reln	UTSW	5	22,106,083 (GRCm38)	missense	probably null	0.39
R5782:Reln	UTSW	5	22,018,056 (GRCm38)	missense	probably benign	0.01
R5815:Reln	UTSW	5	21,947,433 (GRCm38)	missense	probably damaging	0.99
R5838:Reln	UTSW	5	21,899,113 (GRCm38)	missense	probably damaging	0.97
R6162:Reln	UTSW	5	21,911,050 (GRCm38)	missense	probably damaging	1.00
R6219:Reln	UTSW	5	21,948,596 (GRCm38)	missense	probably damaging	1.00
R6259:Reln	UTSW	5	22,060,333 (GRCm38)	missense	probably damaging	0.99
R6279:Reln	UTSW	5	21,896,841 (GRCm38)	missense	probably damaging	1.00
R6299:Reln	UTSW	5	22,286,944 (GRCm38)	missense	possibly damaging	0.71
R6300:Reln	UTSW	5	21,896,841 (GRCm38)	missense	probably damaging	1.00
R6314:Reln	UTSW	5	22,152,484 (GRCm38)	nonsense	probably null
R6351:Reln	UTSW	5	21,901,663 (GRCm38)	nonsense	probably null
R6369:Reln	UTSW	5	22,051,361 (GRCm38)	missense	probably benign	0.03
R6371:Reln	UTSW	5	21,995,513 (GRCm38)	missense	probably benign
R6374:Reln	UTSW	5	22,080,714 (GRCm38)	missense	probably benign	0.06
R6425:Reln	UTSW	5	21,911,020 (GRCm38)	nonsense	probably null
R6442:Reln	UTSW	5	21,932,776 (GRCm38)	missense	probably benign
R6445:Reln	UTSW	5	21,919,214 (GRCm38)	missense	probably benign	0.05
R6554:Reln	UTSW	5	21,896,840 (GRCm38)	missense	probably damaging	1.00
R6641:Reln	UTSW	5	21,929,134 (GRCm38)	missense	probably damaging	1.00
R6768:Reln	UTSW	5	21,978,907 (GRCm38)	missense	probably damaging	0.99
R6859:Reln	UTSW	5	22,034,570 (GRCm38)	missense	probably damaging	1.00
R6896:Reln	UTSW	5	21,899,179 (GRCm38)	missense	probably benign	0.18
R6932:Reln	UTSW	5	21,985,857 (GRCm38)	missense	probably benign	0.00
R6948:Reln	UTSW	5	21,972,035 (GRCm38)	missense	probably damaging	1.00
R6959:Reln	UTSW	5	21,976,564 (GRCm38)	missense	probably damaging	1.00
R7085:Reln	UTSW	5	21,915,087 (GRCm38)	nonsense	probably null
R7091:Reln	UTSW	5	21,899,029 (GRCm38)	missense	probably null	0.08
R7135:Reln	UTSW	5	21,976,596 (GRCm38)	missense	possibly damaging	0.95
R7146:Reln	UTSW	5	22,106,097 (GRCm38)	missense	probably damaging	0.97
R7167:Reln	UTSW	5	21,942,620 (GRCm38)	missense	probably damaging	1.00
R7190:Reln	UTSW	5	22,047,947 (GRCm38)	missense	probably damaging	1.00
R7256:Reln	UTSW	5	21,978,923 (GRCm38)	missense	probably benign	0.03
R7393:Reln	UTSW	5	21,976,351 (GRCm38)	missense	probably damaging	0.99
R7399:Reln	UTSW	5	22,051,367 (GRCm38)	missense	probably damaging	0.99
R7400:Reln	UTSW	5	21,971,934 (GRCm38)	missense	probably damaging	0.99
R7426:Reln	UTSW	5	21,971,953 (GRCm38)	missense	probably damaging	1.00
R7463:Reln	UTSW	5	22,103,435 (GRCm38)	missense	probably damaging	0.98
R7470:Reln	UTSW	5	21,942,741 (GRCm38)	missense	probably damaging	0.99
R7473:Reln	UTSW	5	21,929,127 (GRCm38)	missense	probably benign	0.25
R7501:Reln	UTSW	5	22,227,638 (GRCm38)	missense	possibly damaging	0.91
R7542:Reln	UTSW	5	21,955,181 (GRCm38)	missense	probably damaging	1.00
R7544:Reln	UTSW	5	21,976,278 (GRCm38)	nonsense	probably null
R7588:Reln	UTSW	5	21,885,568 (GRCm38)	missense	probably benign	0.03
R7631:Reln	UTSW	5	21,971,935 (GRCm38)	missense	probably damaging	0.97
R7644:Reln	UTSW	5	21,978,931 (GRCm38)	missense	probably benign	0.39
R7834:Reln	UTSW	5	22,039,635 (GRCm38)	missense	possibly damaging	0.94
R7923:Reln	UTSW	5	22,134,692 (GRCm38)	missense	probably benign	0.00
R7938:Reln	UTSW	5	21,950,872 (GRCm38)	missense	probably damaging	0.97
R8006:Reln	UTSW	5	21,899,084 (GRCm38)	nonsense	probably null
R8062:Reln	UTSW	5	21,971,992 (GRCm38)	missense	probably benign	0.00
R8222:Reln	UTSW	5	21,931,477 (GRCm38)	nonsense	probably null
R8266:Reln	UTSW	5	22,018,087 (GRCm38)	missense	possibly damaging	0.62
R8267:Reln	UTSW	5	22,004,112 (GRCm38)	missense	probably damaging	1.00
R8487:Reln	UTSW	5	21,899,029 (GRCm38)	missense	probably benign	0.03
R8523:Reln	UTSW	5	22,004,231 (GRCm38)	missense	probably damaging	1.00
R8751:Reln	UTSW	5	21,942,674 (GRCm38)	missense	probably benign	0.37
R8801:Reln	UTSW	5	21,950,856 (GRCm38)	missense	possibly damaging	0.94
R8802:Reln	UTSW	5	21,925,259 (GRCm38)	missense	probably damaging	0.98
R8978:Reln	UTSW	5	21,885,514 (GRCm38)	missense	possibly damaging	0.85
R8988:Reln	UTSW	5	21,899,157 (GRCm38)	missense	probably damaging	0.97
R8995:Reln	UTSW	5	21,979,579 (GRCm38)	missense	probably benign	0.00
R9022:Reln	UTSW	5	21,976,615 (GRCm38)	missense	possibly damaging	0.66
R9042:Reln	UTSW	5	22,048,038 (GRCm38)	missense	probably damaging	1.00
R9069:Reln	UTSW	5	22,011,061 (GRCm38)	missense	probably damaging	1.00
R9089:Reln	UTSW	5	21,925,200 (GRCm38)	missense	probably benign	0.01
R9126:Reln	UTSW	5	21,955,196 (GRCm38)	missense	probably damaging	1.00
R9172:Reln	UTSW	5	21,950,817 (GRCm38)	critical splice donor site	probably null
R9182:Reln	UTSW	5	21,901,619 (GRCm38)	missense	probably benign	0.44
R9196:Reln	UTSW	5	22,152,473 (GRCm38)	missense	probably damaging	1.00
R9211:Reln	UTSW	5	22,344,202 (GRCm38)	nonsense	probably null
R9241:Reln	UTSW	5	21,969,069 (GRCm38)	missense	probably damaging	0.99
R9244:Reln	UTSW	5	21,915,153 (GRCm38)	missense	probably damaging	0.99
R9281:Reln	UTSW	5	21,948,547 (GRCm38)	missense	probably damaging	1.00
R9295:Reln	UTSW	5	22,004,211 (GRCm38)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	21,988,707 (GRCm38)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22,080,691 (GRCm38)	missense	probably benign	0.01
R9309:Reln	UTSW	5	21,971,868 (GRCm38)	missense	probably benign	0.37
R9338:Reln	UTSW	5	21,997,939 (GRCm38)	missense	probably damaging	0.98
R9381:Reln	UTSW	5	22,344,204 (GRCm38)	missense	possibly damaging	0.93
R9430:Reln	UTSW	5	21,915,107 (GRCm38)	missense	probably damaging	1.00
R9509:Reln	UTSW	5	22,344,200 (GRCm38)	missense	possibly damaging	0.93
R9515:Reln	UTSW	5	21,920,510 (GRCm38)	missense	possibly damaging	0.46
R9717:Reln	UTSW	5	21,931,429 (GRCm38)	missense	probably benign	0.26
R9745:Reln	UTSW	5	21,947,527 (GRCm38)	missense	probably damaging	1.00
R9778:Reln	UTSW	5	21,950,945 (GRCm38)	missense	probably damaging	1.00
Z1176:Reln	UTSW	5	21,979,024 (GRCm38)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,004,082 (GRCm38)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	21,969,241 (GRCm38)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22,227,636 (GRCm38)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,154,959 (GRCm38)	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TGCAGGAATCTAAACGCAAGC -3'
(R):5'- ACGCTGAAATCAGTTCTGTTG -3'

Sequencing Primer
(F):5'- CGCACAGTCTCTCTCAGAAGGATG -3'
(R):5'- AAGTCCATCGTTTCTACCTGAAATC -3'

Posted On

2016-06-15