Incidental Mutation 'R5125:Carmil2'
ID393502
Institutional Source Beutler Lab
Gene Symbol Carmil2
Ensembl Gene ENSMUSG00000050357
Gene Namecapping protein regulator and myosin 1 linker 2
SynonymsD130029J02Rik, Rltpr
MMRRC Submission 042713-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R5125 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105686274-105698187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105696889 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 1207 (G1207V)
Ref Sequence ENSEMBL: ENSMUSP00000148422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042608] [ENSMUST00000062574] [ENSMUST00000093195] [ENSMUST00000098444] [ENSMUST00000211870] [ENSMUST00000211888] [ENSMUST00000212352] [ENSMUST00000212430] [ENSMUST00000212642] [ENSMUST00000212650] [ENSMUST00000213019]
Predicted Effect probably benign
Transcript: ENSMUST00000042608
SMART Domains Protein: ENSMUSP00000048180
Gene: ENSMUSG00000038000

DomainStartEndE-ValueType
Pfam:TPP1 11 118 2.4e-23 PFAM
low complexity region 259 272 N/A INTRINSIC
low complexity region 296 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000062574
SMART Domains Protein: ENSMUSP00000052322
Gene: ENSMUSG00000050357

DomainStartEndE-ValueType
Pfam:CARMIL_C 149 442 3.3e-62 PFAM
low complexity region 467 484 N/A INTRINSIC
low complexity region 631 659 N/A INTRINSIC
low complexity region 696 727 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093195
SMART Domains Protein: ENSMUSP00000090886
Gene: ENSMUSG00000005699

DomainStartEndE-ValueType
PB1 15 95 2.81e-15 SMART
PDZ 167 250 1.38e-12 SMART
low complexity region 263 286 N/A INTRINSIC
low complexity region 309 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098444
SMART Domains Protein: ENSMUSP00000096043
Gene: ENSMUSG00000005699

DomainStartEndE-ValueType
PB1 4 79 1.28e-9 SMART
PDZ 151 234 1.38e-12 SMART
low complexity region 247 270 N/A INTRINSIC
low complexity region 293 307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211870
Predicted Effect probably benign
Transcript: ENSMUST00000211888
Predicted Effect probably benign
Transcript: ENSMUST00000212352
Predicted Effect probably benign
Transcript: ENSMUST00000212430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212634
Predicted Effect probably benign
Transcript: ENSMUST00000212642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212643
Predicted Effect probably benign
Transcript: ENSMUST00000212650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212972
Predicted Effect probably damaging
Transcript: ENSMUST00000213019
AA Change: G1207V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 96% (49/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out or ENU-induced allele exhibit decreased regulatory T cells and reduced proliferative and IL2-secretion response to anti-CD3 and anti-CD28 antibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dcc A G 18: 71,456,877 F683L probably benign Het
Denr A T 5: 123,927,081 I166F probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Ei24 T A 9: 36,782,446 probably benign Het
Exo5 A T 4: 120,921,537 probably null Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gm7356 T C 17: 14,001,314 D151G probably damaging Het
Grin1 T C 2: 25,296,827 probably benign Het
Grin2b C T 6: 135,923,299 V195M possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kmt2c A G 5: 25,284,381 V4520A probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lmx1a C T 1: 167,830,687 S213L possibly damaging Het
Ly6g6d A G 17: 35,074,442 I8T possibly damaging Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Med12l G A 3: 59,267,214 G1851D possibly damaging Het
Olfr156 T A 4: 43,820,480 I294F probably benign Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
P2rx2 G A 5: 110,342,651 T66I possibly damaging Het
Pcdh15 A G 10: 74,584,080 E1197G probably damaging Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Rbm39 A T 2: 156,162,865 M184K probably damaging Het
Reln A G 5: 21,913,241 V2935A possibly damaging Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Sh3rf3 C G 10: 59,131,190 P785A probably benign Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Slc24a3 T C 2: 145,518,847 V120A possibly damaging Het
Sost C T 11: 101,963,941 G181R probably damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Stim2 T C 5: 54,110,597 S87P probably damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Ugt2b38 A G 5: 87,411,812 M407T probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Zc3h6 A G 2: 129,014,479 H493R possibly damaging Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Znfx1 A T 2: 167,046,939 V783E possibly damaging Het
Other mutations in Carmil2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Carmil2 APN 8 105691406 missense probably benign 0.39
IGL01295:Carmil2 APN 8 105695516 missense probably benign 0.44
IGL02055:Carmil2 APN 8 105696907 splice site probably benign
IGL02532:Carmil2 APN 8 105692431 critical splice donor site probably null
IGL02900:Carmil2 APN 8 105695519 missense probably damaging 1.00
IGL03242:Carmil2 APN 8 105691320 splice site probably benign
IGL03335:Carmil2 APN 8 105697029 missense probably benign 0.14
R0544:Carmil2 UTSW 8 105691235 missense probably damaging 1.00
R2160:Carmil2 UTSW 8 105697048 missense possibly damaging 0.94
R2512:Carmil2 UTSW 8 105697393 missense probably benign 0.31
R2877:Carmil2 UTSW 8 105695423 missense probably damaging 1.00
R2943:Carmil2 UTSW 8 105692932 missense probably benign 0.17
R4038:Carmil2 UTSW 8 105695407 missense probably damaging 0.99
R4615:Carmil2 UTSW 8 105695074 missense possibly damaging 0.94
R4914:Carmil2 UTSW 8 105693543 missense possibly damaging 0.85
R5106:Carmil2 UTSW 8 105694006 splice site probably null
R5178:Carmil2 UTSW 8 105696889 missense probably damaging 1.00
R5735:Carmil2 UTSW 8 105698031 missense probably damaging 1.00
R5991:Carmil2 UTSW 8 105691391 missense probably null 1.00
R6035:Carmil2 UTSW 8 105692563 missense probably benign 0.27
R6035:Carmil2 UTSW 8 105692563 missense probably benign 0.27
R6226:Carmil2 UTSW 8 105689032 missense possibly damaging 0.88
R6411:Carmil2 UTSW 8 105697026 missense probably damaging 1.00
R7263:Carmil2 UTSW 8 105693045 missense probably damaging 1.00
R7368:Carmil2 UTSW 8 105690835 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TCCCAGACTGTAAGGTCAGAG -3'
(R):5'- TTAACATATCCAGTGGCCCTC -3'

Sequencing Primer
(F):5'- AGGGTGGAAACTGGCTTTACC -3'
(R):5'- TCACCAGCAGACACAGAGTGG -3'
Posted On2016-06-15