Mutagenetix > Incidental Mutation

Incidental Mutation 'R5125:Hephl1'

393503

Institutional Source

Beutler Lab

Gene Symbol

Hephl1

Ensembl Gene

ENSMUSG00000031936

Gene Name

hephaestin-like 1

Synonyms

LOC244698, zyklopen, Zp

MMRRC Submission

042713-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R5125 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15051841-15112108 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 15086172 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 399 (K399N)

Ref Sequence

ENSEMBL: ENSMUSP00000124518 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159985]

AlphaFold

Q3V1H3

Predicted Effect

probably damaging
Transcript: ENSMUST00000159985
AA Change: K399N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124518
Gene: ENSMUSG00000031936
AA Change: K399N

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
Pfam:Cu-oxidase_3	97	209	2.8e-12	PFAM
Pfam:Cu-oxidase_2	289	365	2.4e-9	PFAM
Pfam:Cu-oxidase_3	452	564	1.2e-9	PFAM
Blast:FA58C	604	703	9e-9	BLAST
Pfam:Cu-oxidase_3	805	908	1.6e-7	PFAM
Pfam:Cu-oxidase_2	946	1067	9e-14	PFAM
transmembrane domain	1115	1137	N/A	INTRINSIC

Meta Mutation Damage Score

0.0809

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

96% (49/51)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abt1	G	T	13: 23,422,649	A94E	possibly damaging	Het
Carmil2	G	T	8: 105,696,889	G1207V	probably damaging	Het
Cyp2c66	A	G	19: 39,171,029	Y308C	probably damaging	Het
Dcc	A	G	18: 71,456,877	F683L	probably benign	Het
Denr	A	T	5: 123,927,081	I166F	probably damaging	Het
Dhx29	T	G	13: 112,932,600	S155A	possibly damaging	Het
Dsg1b	G	A	18: 20,397,503	G405E	probably damaging	Het
Ei24	T	A	9: 36,782,446		probably benign	Het
Exo5	A	T	4: 120,921,537		probably null	Het
Gm15922	T	A	7: 3,739,397	K44*	probably null	Het
Gm7356	T	C	17: 14,001,314	D151G	probably damaging	Het
Grin1	T	C	2: 25,296,827		probably benign	Het
Grin2b	C	T	6: 135,923,299	V195M	possibly damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kmt2c	A	G	5: 25,284,381	V4520A	probably damaging	Het
Lair1	G	A	7: 4,010,489	T82I	possibly damaging	Het
Lmx1a	C	T	1: 167,830,687	S213L	possibly damaging	Het
Ly6g6d	A	G	17: 35,074,442	I8T	possibly damaging	Het
Mcm4	T	A	16: 15,635,303	D174V	probably benign	Het
Mcph1	T	A	8: 18,607,326	D60E	probably damaging	Het
Med12l	G	A	3: 59,267,214	G1851D	possibly damaging	Het
Olfr156	T	A	4: 43,820,480	I294F	probably benign	Het
Olfr868	T	A	9: 20,101,192	C144*	probably null	Het
P2rx2	G	A	5: 110,342,651	T66I	possibly damaging	Het
Pcdh15	A	G	10: 74,584,080	E1197G	probably damaging	Het
Ppwd1	A	T	13: 104,220,435	S191T	probably benign	Het
Rbm39	A	T	2: 156,162,865	M184K	probably damaging	Het
Reln	A	G	5: 21,913,241	V2935A	possibly damaging	Het
Robo4	T	C	9: 37,407,960	W535R	probably damaging	Het
Rsf1	A	G	7: 97,661,872	D603G	possibly damaging	Het
Sh3rf3	C	G	10: 59,131,190	P785A	probably benign	Het
Slc22a26	T	C	19: 7,790,175	T289A	possibly damaging	Het
Slc24a3	T	C	2: 145,518,847	V120A	possibly damaging	Het
Sost	C	T	11: 101,963,941	G181R	probably damaging	Het
Sp2	A	G	11: 96,955,838	F554L	probably benign	Het
Stim2	T	C	5: 54,110,597	S87P	probably damaging	Het
Tcrg-C4	A	G	13: 19,344,762		probably benign	Het
Tecta	T	C	9: 42,375,185	D725G	probably damaging	Het
Ube4b	T	C	4: 149,342,992	M900V	probably damaging	Het
Ugt2b38	A	G	5: 87,411,812	M407T	probably damaging	Het
Vmn1r87	G	T	7: 13,131,865	A165E	possibly damaging	Het
Zc3h6	A	G	2: 129,014,479	H493R	possibly damaging	Het
Zfhx2	A	T	14: 55,074,775	F154Y	probably benign	Het
Zfp729a	A	G	13: 67,637,645		probably null	Het
Zfp976	A	G	7: 42,612,501		probably null	Het
Zhx1	C	G	15: 58,054,074	G259R	probably damaging	Het
Znfx1	A	T	2: 167,046,939	V783E	possibly damaging	Het

Other mutations in Hephl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Hephl1	APN	9	15067045	missense	probably benign	0.06
IGL01105:Hephl1	APN	9	15089024	missense	possibly damaging	0.95
IGL01731:Hephl1	APN	9	15069770	missense	probably damaging	1.00
IGL02010:Hephl1	APN	9	15090556	nonsense	probably null
IGL02112:Hephl1	APN	9	15081815	splice site	probably benign
IGL02227:Hephl1	APN	9	15069793	missense	probably damaging	1.00
IGL02490:Hephl1	APN	9	15053685	missense	probably benign	0.06
IGL02960:Hephl1	APN	9	15084319	missense	probably damaging	1.00
IGL03265:Hephl1	APN	9	15060959	missense	probably benign	0.14
R0006:Hephl1	UTSW	9	15076764	missense	probably benign	0.16
R0006:Hephl1	UTSW	9	15076764	missense	probably benign	0.16
R0007:Hephl1	UTSW	9	15086175	missense	possibly damaging	0.58
R0092:Hephl1	UTSW	9	15090603	frame shift	probably null
R0421:Hephl1	UTSW	9	15059160	missense	probably benign	0.05
R0448:Hephl1	UTSW	9	15076926	missense	probably damaging	1.00
R0563:Hephl1	UTSW	9	15081945	missense	probably damaging	1.00
R0602:Hephl1	UTSW	9	15089051	missense	probably damaging	0.99
R0631:Hephl1	UTSW	9	15084524	missense	probably benign	0.04
R0747:Hephl1	UTSW	9	15054001	splice site	probably benign
R1123:Hephl1	UTSW	9	15080140	missense	probably benign	0.00
R1386:Hephl1	UTSW	9	15076754	missense	probably benign
R1711:Hephl1	UTSW	9	15059246	missense	probably damaging	1.00
R1743:Hephl1	UTSW	9	15090068	missense	probably damaging	0.99
R1833:Hephl1	UTSW	9	15076928	missense	probably damaging	0.99
R1908:Hephl1	UTSW	9	15074124	nonsense	probably null
R1918:Hephl1	UTSW	9	15076818	missense	probably benign	0.16
R1938:Hephl1	UTSW	9	15053987	missense	possibly damaging	0.88
R1986:Hephl1	UTSW	9	15054552	missense	probably damaging	1.00
R3122:Hephl1	UTSW	9	15088969	missense	possibly damaging	0.90
R3832:Hephl1	UTSW	9	15069748	missense	probably damaging	1.00
R3833:Hephl1	UTSW	9	15069748	missense	probably damaging	1.00
R4280:Hephl1	UTSW	9	15112034	missense	probably benign	0.05
R4434:Hephl1	UTSW	9	15076796	missense	probably damaging	0.99
R4790:Hephl1	UTSW	9	15059171	missense	probably damaging	1.00
R4793:Hephl1	UTSW	9	15097990	missense	probably benign	0.34
R4960:Hephl1	UTSW	9	15086290	missense	probably damaging	1.00
R5152:Hephl1	UTSW	9	15080185	missense	probably damaging	1.00
R5178:Hephl1	UTSW	9	15086172	missense	probably damaging	0.98
R5288:Hephl1	UTSW	9	15076854	missense	possibly damaging	0.83
R5372:Hephl1	UTSW	9	15097899	nonsense	probably null
R5377:Hephl1	UTSW	9	15069788	missense	probably damaging	1.00
R5788:Hephl1	UTSW	9	15084283	missense	possibly damaging	0.93
R5795:Hephl1	UTSW	9	15069760	missense	probably damaging	0.99
R6210:Hephl1	UTSW	9	15090564	missense	possibly damaging	0.57
R6303:Hephl1	UTSW	9	15090152	missense	possibly damaging	0.69
R6394:Hephl1	UTSW	9	15074101	missense	probably benign	0.00
R6653:Hephl1	UTSW	9	15081964	missense	probably damaging	0.99
R6764:Hephl1	UTSW	9	15088921	missense	possibly damaging	0.88
R7114:Hephl1	UTSW	9	15069815	missense	probably damaging	0.96
R7143:Hephl1	UTSW	9	15060810	missense	possibly damaging	0.80
R7404:Hephl1	UTSW	9	15069751	missense	possibly damaging	0.84
R7446:Hephl1	UTSW	9	15098051	missense	probably damaging	1.00
R7447:Hephl1	UTSW	9	15097882	critical splice donor site	probably null
R7715:Hephl1	UTSW	9	15060785	missense	probably benign	0.36
R8013:Hephl1	UTSW	9	15054609	missense	possibly damaging	0.78
R8156:Hephl1	UTSW	9	15060914	missense	possibly damaging	0.77
R8755:Hephl1	UTSW	9	15074267	missense	probably benign
R8755:Hephl1	UTSW	9	15111984	missense	probably damaging	1.00
R8777:Hephl1	UTSW	9	15060794	missense	probably benign	0.24
R8777-TAIL:Hephl1	UTSW	9	15060794	missense	probably benign	0.24
R9090:Hephl1	UTSW	9	15076940	missense	probably damaging	1.00
R9155:Hephl1	UTSW	9	15089079	missense	probably damaging	1.00
R9271:Hephl1	UTSW	9	15076940	missense	probably damaging	1.00
R9287:Hephl1	UTSW	9	15084479	missense	probably benign	0.01
R9487:Hephl1	UTSW	9	15084534	missense	possibly damaging	0.84
X0026:Hephl1	UTSW	9	15084228	critical splice donor site	probably null
X0066:Hephl1	UTSW	9	15053668	missense	probably benign	0.00
Z1088:Hephl1	UTSW	9	15053721	missense	probably damaging	1.00
Z1177:Hephl1	UTSW	9	15090054	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCCCAGTTCTCAGCAGTG -3'
(R):5'- AATGCTGATGCTTGTTTCAAACCTG -3'

Sequencing Primer
(F):5'- CAGTTCTCAGCAGTGTCCTCAATAAG -3'
(R):5'- GGCGGTTCATCCATGCCTTG -3'

Posted On

2016-06-15